ID: 1014837330

View in Genome Browser
Species Human (GRCh38)
Location 6:126174159-126174181
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837321_1014837330 2 Left 1014837321 6:126174134-126174156 CCCCACTGTCGCCCACTCCTCAT No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837318_1014837330 27 Left 1014837318 6:126174109-126174131 CCTCACCTTTCTGCAGCCTCTCA No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837319_1014837330 22 Left 1014837319 6:126174114-126174136 CCTTTCTGCAGCCTCTCACTCCC No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837320_1014837330 11 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837322_1014837330 1 Left 1014837322 6:126174135-126174157 CCCACTGTCGCCCACTCCTCATA No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837325_1014837330 -9 Left 1014837325 6:126174145-126174167 CCCACTCCTCATAGGCTATCCTC No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837326_1014837330 -10 Left 1014837326 6:126174146-126174168 CCACTCCTCATAGGCTATCCTCA No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data
1014837323_1014837330 0 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837330 6:126174159-126174181 GCTATCCTCAGGAATGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837330 Original CRISPR GCTATCCTCAGGAATGGCAT TGG Intergenic