ID: 1014837333

View in Genome Browser
Species Human (GRCh38)
Location 6:126174170-126174192
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014837323_1014837333 11 Left 1014837323 6:126174136-126174158 CCACTGTCGCCCACTCCTCATAG No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837320_1014837333 22 Left 1014837320 6:126174125-126174147 CCTCTCACTCCCCACTGTCGCCC No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837322_1014837333 12 Left 1014837322 6:126174135-126174157 CCCACTGTCGCCCACTCCTCATA No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837321_1014837333 13 Left 1014837321 6:126174134-126174156 CCCCACTGTCGCCCACTCCTCAT No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837326_1014837333 1 Left 1014837326 6:126174146-126174168 CCACTCCTCATAGGCTATCCTCA No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837325_1014837333 2 Left 1014837325 6:126174145-126174167 CCCACTCCTCATAGGCTATCCTC No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data
1014837328_1014837333 -4 Left 1014837328 6:126174151-126174173 CCTCATAGGCTATCCTCAGGAAT No data
Right 1014837333 6:126174170-126174192 GAATGGCATTGGTGGAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014837333 Original CRISPR GAATGGCATTGGTGGAGTGT TGG Intergenic
No off target data available for this crispr