ID: 1014843501

View in Genome Browser
Species Human (GRCh38)
Location 6:126247102-126247124
Sequence CAAGCTAAGCCCATACAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014843501_1014843506 18 Left 1014843501 6:126247102-126247124 CCTCGCTGTATGGGCTTAGCTTG No data
Right 1014843506 6:126247143-126247165 CATGGTTTAAAAAGACTTGTGGG No data
1014843501_1014843502 0 Left 1014843501 6:126247102-126247124 CCTCGCTGTATGGGCTTAGCTTG No data
Right 1014843502 6:126247125-126247147 CTCCCTGATTTCTGCTCACATGG No data
1014843501_1014843505 17 Left 1014843501 6:126247102-126247124 CCTCGCTGTATGGGCTTAGCTTG No data
Right 1014843505 6:126247142-126247164 ACATGGTTTAAAAAGACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014843501 Original CRISPR CAAGCTAAGCCCATACAGCG AGG (reversed) Intergenic
No off target data available for this crispr