ID: 1014843506

View in Genome Browser
Species Human (GRCh38)
Location 6:126247143-126247165
Sequence CATGGTTTAAAAAGACTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014843501_1014843506 18 Left 1014843501 6:126247102-126247124 CCTCGCTGTATGGGCTTAGCTTG No data
Right 1014843506 6:126247143-126247165 CATGGTTTAAAAAGACTTGTGGG No data
1014843503_1014843506 -7 Left 1014843503 6:126247127-126247149 CCCTGATTTCTGCTCACATGGTT No data
Right 1014843506 6:126247143-126247165 CATGGTTTAAAAAGACTTGTGGG No data
1014843504_1014843506 -8 Left 1014843504 6:126247128-126247150 CCTGATTTCTGCTCACATGGTTT No data
Right 1014843506 6:126247143-126247165 CATGGTTTAAAAAGACTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014843506 Original CRISPR CATGGTTTAAAAAGACTTGT GGG Intergenic
No off target data available for this crispr