ID: 1014848727

View in Genome Browser
Species Human (GRCh38)
Location 6:126313507-126313529
Sequence CAGTGTCAGAGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014848727_1014848738 20 Left 1014848727 6:126313507-126313529 CCCTCTTCCCTCCTCTGACACTG No data
Right 1014848738 6:126313550-126313572 AGTTAGCAAGATGGTGGTGCAGG No data
1014848727_1014848735 11 Left 1014848727 6:126313507-126313529 CCCTCTTCCCTCCTCTGACACTG No data
Right 1014848735 6:126313541-126313563 CAAAACCACAGTTAGCAAGATGG No data
1014848727_1014848739 28 Left 1014848727 6:126313507-126313529 CCCTCTTCCCTCCTCTGACACTG No data
Right 1014848739 6:126313558-126313580 AGATGGTGGTGCAGGAGTGAAGG No data
1014848727_1014848736 14 Left 1014848727 6:126313507-126313529 CCCTCTTCCCTCCTCTGACACTG No data
Right 1014848736 6:126313544-126313566 AACCACAGTTAGCAAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014848727 Original CRISPR CAGTGTCAGAGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr