ID: 1014851831

View in Genome Browser
Species Human (GRCh38)
Location 6:126350002-126350024
Sequence CAGGTGCAAGCTGCTGTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014851822_1014851831 19 Left 1014851822 6:126349960-126349982 CCTTTAGCCTCCTGAGTAGCCTC No data
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data
1014851821_1014851831 22 Left 1014851821 6:126349957-126349979 CCTCCTTTAGCCTCCTGAGTAGC 0: 12
1: 391
2: 10081
3: 112480
4: 207122
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data
1014851823_1014851831 12 Left 1014851823 6:126349967-126349989 CCTCCTGAGTAGCCTCCTTCTTG No data
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data
1014851827_1014851831 0 Left 1014851827 6:126349979-126350001 CCTCCTTCTTGCACCTGGGATCA No data
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data
1014851824_1014851831 9 Left 1014851824 6:126349970-126349992 CCTGAGTAGCCTCCTTCTTGCAC No data
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data
1014851828_1014851831 -3 Left 1014851828 6:126349982-126350004 CCTTCTTGCACCTGGGATCACAG No data
Right 1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014851831 Original CRISPR CAGGTGCAAGCTGCTGTGTT CGG Intergenic
No off target data available for this crispr