ID: 1014853109

View in Genome Browser
Species Human (GRCh38)
Location 6:126365519-126365541
Sequence CTCTGTTATGAGAACAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014853106_1014853109 -7 Left 1014853106 6:126365503-126365525 CCAGATCTCCTGAGAACTCTGTT No data
Right 1014853109 6:126365519-126365541 CTCTGTTATGAGAACAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014853109 Original CRISPR CTCTGTTATGAGAACAGCAA GGG Intergenic
No off target data available for this crispr