ID: 1014865920

View in Genome Browser
Species Human (GRCh38)
Location 6:126530023-126530045
Sequence GGACTCTGCTTGAGTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014865920_1014865928 1 Left 1014865920 6:126530023-126530045 CCACTTCCACTCAAGCAGAGTCC No data
Right 1014865928 6:126530047-126530069 AGATCATATTGGGGTTCAAAGGG No data
1014865920_1014865924 -8 Left 1014865920 6:126530023-126530045 CCACTTCCACTCAAGCAGAGTCC No data
Right 1014865924 6:126530038-126530060 CAGAGTCCCAGATCATATTGGGG No data
1014865920_1014865922 -10 Left 1014865920 6:126530023-126530045 CCACTTCCACTCAAGCAGAGTCC No data
Right 1014865922 6:126530036-126530058 AGCAGAGTCCCAGATCATATTGG No data
1014865920_1014865927 0 Left 1014865920 6:126530023-126530045 CCACTTCCACTCAAGCAGAGTCC No data
Right 1014865927 6:126530046-126530068 CAGATCATATTGGGGTTCAAAGG No data
1014865920_1014865923 -9 Left 1014865920 6:126530023-126530045 CCACTTCCACTCAAGCAGAGTCC No data
Right 1014865923 6:126530037-126530059 GCAGAGTCCCAGATCATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014865920 Original CRISPR GGACTCTGCTTGAGTGGAAG TGG (reversed) Intergenic
No off target data available for this crispr