ID: 1014867817

View in Genome Browser
Species Human (GRCh38)
Location 6:126553425-126553447
Sequence CTGTAGAAAGGGACAACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014867817_1014867821 6 Left 1014867817 6:126553425-126553447 CCTTGTGTTGTCCCTTTCTACAG No data
Right 1014867821 6:126553454-126553476 TGGTTGACCTACGTAATAAAAGG No data
1014867817_1014867823 23 Left 1014867817 6:126553425-126553447 CCTTGTGTTGTCCCTTTCTACAG No data
Right 1014867823 6:126553471-126553493 AAAAGGATATTGACAAAATTAGG No data
1014867817_1014867824 24 Left 1014867817 6:126553425-126553447 CCTTGTGTTGTCCCTTTCTACAG No data
Right 1014867824 6:126553472-126553494 AAAGGATATTGACAAAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014867817 Original CRISPR CTGTAGAAAGGGACAACACA AGG (reversed) Intergenic
No off target data available for this crispr