ID: 1014869973

View in Genome Browser
Species Human (GRCh38)
Location 6:126581949-126581971
Sequence AAGAAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014869973_1014869979 10 Left 1014869973 6:126581949-126581971 CCCTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1014869979 6:126581982-126582004 TTCTTCATTTTTTTGTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014869973 Original CRISPR AAGAAGAAGGAGGAGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr