ID: 1014873482

View in Genome Browser
Species Human (GRCh38)
Location 6:126626594-126626616
Sequence GGCTTACCAAAGCCAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014873482_1014873488 26 Left 1014873482 6:126626594-126626616 CCCACAGTTGGCTTTGGTAAGCC No data
Right 1014873488 6:126626643-126626665 TAAATGAGAAGCTACAGTAGGGG No data
1014873482_1014873486 24 Left 1014873482 6:126626594-126626616 CCCACAGTTGGCTTTGGTAAGCC No data
Right 1014873486 6:126626641-126626663 ACTAAATGAGAAGCTACAGTAGG No data
1014873482_1014873487 25 Left 1014873482 6:126626594-126626616 CCCACAGTTGGCTTTGGTAAGCC No data
Right 1014873487 6:126626642-126626664 CTAAATGAGAAGCTACAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014873482 Original CRISPR GGCTTACCAAAGCCAACTGT GGG (reversed) Intergenic
No off target data available for this crispr