ID: 1014873486

View in Genome Browser
Species Human (GRCh38)
Location 6:126626641-126626663
Sequence ACTAAATGAGAAGCTACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014873484_1014873486 3 Left 1014873484 6:126626615-126626637 CCAGCATCAGCTGTCTCCAGCAC No data
Right 1014873486 6:126626641-126626663 ACTAAATGAGAAGCTACAGTAGG No data
1014873483_1014873486 23 Left 1014873483 6:126626595-126626617 CCACAGTTGGCTTTGGTAAGCCA No data
Right 1014873486 6:126626641-126626663 ACTAAATGAGAAGCTACAGTAGG No data
1014873482_1014873486 24 Left 1014873482 6:126626594-126626616 CCCACAGTTGGCTTTGGTAAGCC No data
Right 1014873486 6:126626641-126626663 ACTAAATGAGAAGCTACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014873486 Original CRISPR ACTAAATGAGAAGCTACAGT AGG Intergenic
No off target data available for this crispr