ID: 1014882366

View in Genome Browser
Species Human (GRCh38)
Location 6:126739122-126739144
Sequence GAGAATTCCAACTATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014882366_1014882370 13 Left 1014882366 6:126739122-126739144 CCAACCTCATAGTTGGAATTCTC No data
Right 1014882370 6:126739158-126739180 CAAAAGCCTGGATTCAGCCCAGG No data
1014882366_1014882369 1 Left 1014882366 6:126739122-126739144 CCAACCTCATAGTTGGAATTCTC No data
Right 1014882369 6:126739146-126739168 ATATCAATCAGACAAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014882366 Original CRISPR GAGAATTCCAACTATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr