ID: 1014882705

View in Genome Browser
Species Human (GRCh38)
Location 6:126743293-126743315
Sequence GCTGCTGGGGATCCTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014882696_1014882705 18 Left 1014882696 6:126743252-126743274 CCTGCATGTTCAGCCTGCCAGCA No data
Right 1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG No data
1014882699_1014882705 1 Left 1014882699 6:126743269-126743291 CCAGCAGGCTCAGCCATTTCTGG No data
Right 1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG No data
1014882698_1014882705 5 Left 1014882698 6:126743265-126743287 CCTGCCAGCAGGCTCAGCCATTT No data
Right 1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014882705 Original CRISPR GCTGCTGGGGATCCTCTAGC TGG Intergenic
No off target data available for this crispr