ID: 1014887425

View in Genome Browser
Species Human (GRCh38)
Location 6:126798704-126798726
Sequence GAACCCTGAATATCAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014887422_1014887425 0 Left 1014887422 6:126798681-126798703 CCCAGCCAAGAATATTGGGGTGT No data
Right 1014887425 6:126798704-126798726 GAACCCTGAATATCAGAGACAGG No data
1014887424_1014887425 -5 Left 1014887424 6:126798686-126798708 CCAAGAATATTGGGGTGTGAACC No data
Right 1014887425 6:126798704-126798726 GAACCCTGAATATCAGAGACAGG No data
1014887423_1014887425 -1 Left 1014887423 6:126798682-126798704 CCAGCCAAGAATATTGGGGTGTG No data
Right 1014887425 6:126798704-126798726 GAACCCTGAATATCAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014887425 Original CRISPR GAACCCTGAATATCAGAGAC AGG Intergenic
No off target data available for this crispr