ID: 1014889449

View in Genome Browser
Species Human (GRCh38)
Location 6:126824911-126824933
Sequence TGTTCTAGAGATATGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014889446_1014889449 17 Left 1014889446 6:126824871-126824893 CCATTTGCTTGTGGGAAGAAGTG No data
Right 1014889449 6:126824911-126824933 TGTTCTAGAGATATGGCATATGG No data
1014889447_1014889449 -7 Left 1014889447 6:126824895-126824917 CCTTACTCTGCTGACATGTTCTA No data
Right 1014889449 6:126824911-126824933 TGTTCTAGAGATATGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014889449 Original CRISPR TGTTCTAGAGATATGGCATA TGG Intergenic
No off target data available for this crispr