ID: 1014892354

View in Genome Browser
Species Human (GRCh38)
Location 6:126858168-126858190
Sequence TTGCAACCCTCGGACCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014892354_1014892360 30 Left 1014892354 6:126858168-126858190 CCTGTAGGGTCCGAGGGTTGCAA No data
Right 1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG No data
1014892354_1014892358 20 Left 1014892354 6:126858168-126858190 CCTGTAGGGTCCGAGGGTTGCAA No data
Right 1014892358 6:126858211-126858233 CGGCAAACCAGCTCAAGCCCAGG No data
1014892354_1014892357 0 Left 1014892354 6:126858168-126858190 CCTGTAGGGTCCGAGGGTTGCAA No data
Right 1014892357 6:126858191-126858213 CTTCTGAGTACTGGTGATTGCGG No data
1014892354_1014892356 -9 Left 1014892354 6:126858168-126858190 CCTGTAGGGTCCGAGGGTTGCAA No data
Right 1014892356 6:126858182-126858204 GGGTTGCAACTTCTGAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014892354 Original CRISPR TTGCAACCCTCGGACCCTAC AGG (reversed) Intergenic
No off target data available for this crispr