ID: 1014892360

View in Genome Browser
Species Human (GRCh38)
Location 6:126858221-126858243
Sequence GCTCAAGCCCAGGCTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014892354_1014892360 30 Left 1014892354 6:126858168-126858190 CCTGTAGGGTCCGAGGGTTGCAA No data
Right 1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG No data
1014892355_1014892360 20 Left 1014892355 6:126858178-126858200 CCGAGGGTTGCAACTTCTGAGTA No data
Right 1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014892360 Original CRISPR GCTCAAGCCCAGGCTGAAGA AGG Intergenic
No off target data available for this crispr