ID: 1014895655

View in Genome Browser
Species Human (GRCh38)
Location 6:126896584-126896606
Sequence GACAGCTCTTGGCCTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014895652_1014895655 3 Left 1014895652 6:126896558-126896580 CCCAAATAACTACTCTCATTTTG No data
Right 1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG No data
1014895653_1014895655 2 Left 1014895653 6:126896559-126896581 CCAAATAACTACTCTCATTTTGA No data
Right 1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG No data
1014895649_1014895655 15 Left 1014895649 6:126896546-126896568 CCTACCATCATCCCCAAATAACT No data
Right 1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG No data
1014895650_1014895655 11 Left 1014895650 6:126896550-126896572 CCATCATCCCCAAATAACTACTC No data
Right 1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG No data
1014895651_1014895655 4 Left 1014895651 6:126896557-126896579 CCCCAAATAACTACTCTCATTTT No data
Right 1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014895655 Original CRISPR GACAGCTCTTGGCCTGATAA TGG Intergenic
No off target data available for this crispr