ID: 1014901659

View in Genome Browser
Species Human (GRCh38)
Location 6:126973006-126973028
Sequence CTCACTCTATTAACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014901656_1014901659 21 Left 1014901656 6:126972962-126972984 CCTCTCAAGACCTAGGTTGAGAA No data
Right 1014901659 6:126973006-126973028 CTCACTCTATTAACTAGAGCAGG No data
1014901657_1014901659 11 Left 1014901657 6:126972972-126972994 CCTAGGTTGAGAAAAGACATACT No data
Right 1014901659 6:126973006-126973028 CTCACTCTATTAACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014901659 Original CRISPR CTCACTCTATTAACTAGAGC AGG Intergenic
No off target data available for this crispr