ID: 1014901686

View in Genome Browser
Species Human (GRCh38)
Location 6:126973315-126973337
Sequence AGGTTTTAAGAAATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014901683_1014901686 23 Left 1014901683 6:126973269-126973291 CCAGCTTTAGTGTCTGTTGTCTA No data
Right 1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014901686 Original CRISPR AGGTTTTAAGAAATGGAGAA TGG Intergenic
No off target data available for this crispr