ID: 1014906246

View in Genome Browser
Species Human (GRCh38)
Location 6:127032162-127032184
Sequence TCTTATCTTAAGAAAGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014906246_1014906247 24 Left 1014906246 6:127032162-127032184 CCAACTACTTTCTTAAGATAAGA No data
Right 1014906247 6:127032209-127032231 AAAGTTGAGTTACATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014906246 Original CRISPR TCTTATCTTAAGAAAGTAGT TGG (reversed) Intergenic
No off target data available for this crispr