ID: 1014910413

View in Genome Browser
Species Human (GRCh38)
Location 6:127085911-127085933
Sequence GAGAAAACTGAGCTCCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014910413_1014910418 18 Left 1014910413 6:127085911-127085933 CCCCCAAGGAGCTCAGTTTTCTC No data
Right 1014910418 6:127085952-127085974 AAAGTCATTTTTAATTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014910413 Original CRISPR GAGAAAACTGAGCTCCTTGG GGG (reversed) Intergenic