ID: 1014913169

View in Genome Browser
Species Human (GRCh38)
Location 6:127118060-127118082
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 204}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913169_1014913176 8 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913176 6:127118091-127118113 AGCGATCTGCCAAGGGGGAGAGG No data
1014913169_1014913172 1 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913172 6:127118084-127118106 ACTCTCCAGCGATCTGCCAAGGG No data
1014913169_1014913180 29 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data
1014913169_1014913173 2 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913173 6:127118085-127118107 CTCTCCAGCGATCTGCCAAGGGG No data
1014913169_1014913174 3 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913174 6:127118086-127118108 TCTCCAGCGATCTGCCAAGGGGG No data
1014913169_1014913181 30 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913169_1014913179 23 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913179 6:127118106-127118128 GGGAGAGGGTAGTTGCGCGCCGG No data
1014913169_1014913171 0 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913171 6:127118083-127118105 AACTCTCCAGCGATCTGCCAAGG No data
1014913169_1014913177 9 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913177 6:127118092-127118114 GCGATCTGCCAAGGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913169 Original CRISPR TCTGGCTGCTGACTTGTTCC CGG (reversed) Intergenic