ID: 1014913170

View in Genome Browser
Species Human (GRCh38)
Location 6:127118078-127118100
Sequence GCAGATCGCTGGAGAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913187 23 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data
1014913170_1014913189 24 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913189 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
1014913170_1014913186 22 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG No data
1014913170_1014913179 5 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913179 6:127118106-127118128 GGGAGAGGGTAGTTGCGCGCCGG No data
1014913170_1014913183 17 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data
1014913170_1014913182 13 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data
1014913170_1014913190 25 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913190 6:127118126-127118148 CGGCGCTGGGGATGGGGTGGGGG No data
1014913170_1014913180 11 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data
1014913170_1014913181 12 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913170_1014913177 -9 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913177 6:127118092-127118114 GCGATCTGCCAAGGGGGAGAGGG No data
1014913170_1014913185 19 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913185 6:127118120-127118142 GCGCGCCGGCGCTGGGGATGGGG No data
1014913170_1014913176 -10 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913176 6:127118091-127118113 AGCGATCTGCCAAGGGGGAGAGG No data
1014913170_1014913184 18 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913184 6:127118119-127118141 TGCGCGCCGGCGCTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913170 Original CRISPR GCAGATCGCTGGAGAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr