ID: 1014913175

View in Genome Browser
Species Human (GRCh38)
Location 6:127118089-127118111
Sequence TCTCCCCCTTGGCAGATCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913175_1014913195 30 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913195 6:127118142-127118164 GTGGGGGCGCTGGGGCACAAGGG No data
1014913175_1014913193 22 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913193 6:127118134-127118156 GGGATGGGGTGGGGGCGCTGGGG No data
1014913175_1014913190 14 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913190 6:127118126-127118148 CGGCGCTGGGGATGGGGTGGGGG No data
1014913175_1014913183 6 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data
1014913175_1014913181 1 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913175_1014913192 21 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913192 6:127118133-127118155 GGGGATGGGGTGGGGGCGCTGGG No data
1014913175_1014913180 0 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data
1014913175_1014913185 8 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913185 6:127118120-127118142 GCGCGCCGGCGCTGGGGATGGGG No data
1014913175_1014913184 7 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913184 6:127118119-127118141 TGCGCGCCGGCGCTGGGGATGGG No data
1014913175_1014913182 2 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data
1014913175_1014913194 29 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data
1014913175_1014913189 13 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913189 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
1014913175_1014913191 20 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913191 6:127118132-127118154 TGGGGATGGGGTGGGGGCGCTGG No data
1014913175_1014913179 -6 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913179 6:127118106-127118128 GGGAGAGGGTAGTTGCGCGCCGG No data
1014913175_1014913186 11 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG No data
1014913175_1014913187 12 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913175 Original CRISPR TCTCCCCCTTGGCAGATCGC TGG (reversed) Intergenic
No off target data available for this crispr