ID: 1014913176

View in Genome Browser
Species Human (GRCh38)
Location 6:127118091-127118113
Sequence AGCGATCTGCCAAGGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913176 -10 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913176 6:127118091-127118113 AGCGATCTGCCAAGGGGGAGAGG No data
1014913169_1014913176 8 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA No data
Right 1014913176 6:127118091-127118113 AGCGATCTGCCAAGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913176 Original CRISPR AGCGATCTGCCAAGGGGGAG AGG Intergenic