ID: 1014913177

View in Genome Browser
Species Human (GRCh38)
Location 6:127118092-127118114
Sequence GCGATCTGCCAAGGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913169_1014913177 9 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA No data
Right 1014913177 6:127118092-127118114 GCGATCTGCCAAGGGGGAGAGGG No data
1014913170_1014913177 -9 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913177 6:127118092-127118114 GCGATCTGCCAAGGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913177 Original CRISPR GCGATCTGCCAAGGGGGAGA GGG Intergenic