ID: 1014913178

View in Genome Browser
Species Human (GRCh38)
Location 6:127118100-127118122
Sequence CGCAACTACCCTCTCCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913178_1014913185 -3 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913185 6:127118120-127118142 GCGCGCCGGCGCTGGGGATGGGG No data
1014913178_1014913196 25 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913196 6:127118148-127118170 GCGCTGGGGCACAAGGGCGCAGG No data
1014913178_1014913191 9 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913191 6:127118132-127118154 TGGGGATGGGGTGGGGGCGCTGG No data
1014913178_1014913189 2 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913189 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
1014913178_1014913181 -10 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913178_1014913187 1 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data
1014913178_1014913197 26 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913197 6:127118149-127118171 CGCTGGGGCACAAGGGCGCAGGG No data
1014913178_1014913193 11 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913193 6:127118134-127118156 GGGATGGGGTGGGGGCGCTGGGG No data
1014913178_1014913184 -4 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913184 6:127118119-127118141 TGCGCGCCGGCGCTGGGGATGGG No data
1014913178_1014913194 18 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data
1014913178_1014913186 0 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG No data
1014913178_1014913195 19 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913195 6:127118142-127118164 GTGGGGGCGCTGGGGCACAAGGG No data
1014913178_1014913192 10 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913192 6:127118133-127118155 GGGGATGGGGTGGGGGCGCTGGG No data
1014913178_1014913198 27 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913198 6:127118150-127118172 GCTGGGGCACAAGGGCGCAGGGG No data
1014913178_1014913182 -9 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data
1014913178_1014913190 3 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913190 6:127118126-127118148 CGGCGCTGGGGATGGGGTGGGGG No data
1014913178_1014913183 -5 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913178 Original CRISPR CGCAACTACCCTCTCCCCCT TGG (reversed) Intergenic