ID: 1014913180

View in Genome Browser
Species Human (GRCh38)
Location 6:127118112-127118134
Sequence GGGTAGTTGCGCGCCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913180 11 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data
1014913175_1014913180 0 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data
1014913169_1014913180 29 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1014913180 6:127118112-127118134 GGGTAGTTGCGCGCCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913180 Original CRISPR GGGTAGTTGCGCGCCGGCGC TGG Intergenic