ID: 1014913181

View in Genome Browser
Species Human (GRCh38)
Location 6:127118113-127118135
Sequence GGTAGTTGCGCGCCGGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913181 12 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913178_1014913181 -10 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913175_1014913181 1 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data
1014913169_1014913181 30 Left 1014913169 6:127118060-127118082 CCGGGAACAAGTCAGCAGCCAGA No data
Right 1014913181 6:127118113-127118135 GGTAGTTGCGCGCCGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913181 Original CRISPR GGTAGTTGCGCGCCGGCGCT GGG Intergenic