ID: 1014913182

View in Genome Browser
Species Human (GRCh38)
Location 6:127118114-127118136
Sequence GTAGTTGCGCGCCGGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913182 13 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data
1014913178_1014913182 -9 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG 0: 1
1: 0
2: 2
3: 8
4: 99
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data
1014913175_1014913182 2 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913182 6:127118114-127118136 GTAGTTGCGCGCCGGCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913182 Original CRISPR GTAGTTGCGCGCCGGCGCTG GGG Intergenic