ID: 1014913183

View in Genome Browser
Species Human (GRCh38)
Location 6:127118118-127118140
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913183 17 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data
1014913178_1014913183 -5 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data
1014913175_1014913183 6 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913183 6:127118118-127118140 TTGCGCGCCGGCGCTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913183 Original CRISPR TTGCGCGCCGGCGCTGGGGA TGG Intergenic