ID: 1014913185 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:127118120-127118142 |
Sequence | GCGCGCCGGCGCTGGGGATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1014913170_1014913185 | 19 | Left | 1014913170 | 6:127118078-127118100 | CCAGAAACTCTCCAGCGATCTGC | No data | ||
Right | 1014913185 | 6:127118120-127118142 | GCGCGCCGGCGCTGGGGATGGGG | No data | ||||
1014913175_1014913185 | 8 | Left | 1014913175 | 6:127118089-127118111 | CCAGCGATCTGCCAAGGGGGAGA | No data | ||
Right | 1014913185 | 6:127118120-127118142 | GCGCGCCGGCGCTGGGGATGGGG | No data | ||||
1014913178_1014913185 | -3 | Left | 1014913178 | 6:127118100-127118122 | CCAAGGGGGAGAGGGTAGTTGCG | No data | ||
Right | 1014913185 | 6:127118120-127118142 | GCGCGCCGGCGCTGGGGATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1014913185 | Original CRISPR | GCGCGCCGGCGCTGGGGATG GGG | Intergenic | ||