ID: 1014913187

View in Genome Browser
Species Human (GRCh38)
Location 6:127118124-127118146
Sequence GCCGGCGCTGGGGATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913170_1014913187 23 Left 1014913170 6:127118078-127118100 CCAGAAACTCTCCAGCGATCTGC No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data
1014913178_1014913187 1 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data
1014913175_1014913187 12 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913187 6:127118124-127118146 GCCGGCGCTGGGGATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913187 Original CRISPR GCCGGCGCTGGGGATGGGGT GGG Intergenic
No off target data available for this crispr