ID: 1014913188

View in Genome Browser
Species Human (GRCh38)
Location 6:127118125-127118147
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913188_1014913201 24 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913201 6:127118172-127118194 GCGCACGGCCACCGACAGCCGGG No data
1014913188_1014913199 9 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913199 6:127118157-127118179 CACAAGGGCGCAGGGGCGCACGG No data
1014913188_1014913195 -6 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913195 6:127118142-127118164 GTGGGGGCGCTGGGGCACAAGGG No data
1014913188_1014913196 0 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913196 6:127118148-127118170 GCGCTGGGGCACAAGGGCGCAGG No data
1014913188_1014913194 -7 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data
1014913188_1014913200 23 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913200 6:127118171-127118193 GGCGCACGGCCACCGACAGCCGG No data
1014913188_1014913198 2 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913198 6:127118150-127118172 GCTGGGGCACAAGGGCGCAGGGG No data
1014913188_1014913197 1 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913197 6:127118149-127118171 CGCTGGGGCACAAGGGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913188 Original CRISPR CCCCACCCCATCCCCAGCGC CGG (reversed) Intergenic