ID: 1014913192 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:127118133-127118155 |
| Sequence | GGGGATGGGGTGGGGGCGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014913178_1014913192 | 10 | Left | 1014913178 | 6:127118100-127118122 | CCAAGGGGGAGAGGGTAGTTGCG | No data | ||
| Right | 1014913192 | 6:127118133-127118155 | GGGGATGGGGTGGGGGCGCTGGG | No data | ||||
| 1014913175_1014913192 | 21 | Left | 1014913175 | 6:127118089-127118111 | CCAGCGATCTGCCAAGGGGGAGA | No data | ||
| Right | 1014913192 | 6:127118133-127118155 | GGGGATGGGGTGGGGGCGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014913192 | Original CRISPR | GGGGATGGGGTGGGGGCGCT GGG | Intergenic | ||