ID: 1014913194

View in Genome Browser
Species Human (GRCh38)
Location 6:127118141-127118163
Sequence GGTGGGGGCGCTGGGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913178_1014913194 18 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data
1014913188_1014913194 -7 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data
1014913175_1014913194 29 Left 1014913175 6:127118089-127118111 CCAGCGATCTGCCAAGGGGGAGA No data
Right 1014913194 6:127118141-127118163 GGTGGGGGCGCTGGGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913194 Original CRISPR GGTGGGGGCGCTGGGGCACA AGG Intergenic