ID: 1014913198

View in Genome Browser
Species Human (GRCh38)
Location 6:127118150-127118172
Sequence GCTGGGGCACAAGGGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913178_1014913198 27 Left 1014913178 6:127118100-127118122 CCAAGGGGGAGAGGGTAGTTGCG No data
Right 1014913198 6:127118150-127118172 GCTGGGGCACAAGGGCGCAGGGG No data
1014913188_1014913198 2 Left 1014913188 6:127118125-127118147 CCGGCGCTGGGGATGGGGTGGGG No data
Right 1014913198 6:127118150-127118172 GCTGGGGCACAAGGGCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913198 Original CRISPR GCTGGGGCACAAGGGCGCAG GGG Intergenic