ID: 1014913575

View in Genome Browser
Species Human (GRCh38)
Location 6:127119821-127119843
Sequence TGTCGGGGATGCGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014913575_1014913588 15 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913588 6:127119859-127119881 AAAGGGCGCGCGAGGCGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1014913575_1014913581 -3 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913581 6:127119841-127119863 ACACGCACCAGCGGAGCCAAAGG 0: 1
1: 0
2: 1
3: 2
4: 54
1014913575_1014913584 7 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913584 6:127119851-127119873 GCGGAGCCAAAGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 85
1014913575_1014913586 13 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913586 6:127119857-127119879 CCAAAGGGCGCGCGAGGCGATGG 0: 1
1: 0
2: 1
3: 0
4: 42
1014913575_1014913582 -2 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913582 6:127119842-127119864 CACGCACCAGCGGAGCCAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 54
1014913575_1014913587 14 Left 1014913575 6:127119821-127119843 CCTGCGCGGCCGCATCCCCGACA 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1014913587 6:127119858-127119880 CAAAGGGCGCGCGAGGCGATGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014913575 Original CRISPR TGTCGGGGATGCGGCCGCGC AGG (reversed) Intronic