ID: 1014916116

View in Genome Browser
Species Human (GRCh38)
Location 6:127150665-127150687
Sequence CTTGGGCTGAGATCTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014916110_1014916116 24 Left 1014916110 6:127150618-127150640 CCATGGAGGTGCTTTTCAAAGTC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1014916116 6:127150665-127150687 CTTGGGCTGAGATCTCTTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1014916113_1014916116 -4 Left 1014916113 6:127150646-127150668 CCAAAAGAACTTGAAGGTTCTTG 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1014916116 6:127150665-127150687 CTTGGGCTGAGATCTCTTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1014916111_1014916116 2 Left 1014916111 6:127150640-127150662 CCTTTGCCAAAAGAACTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1014916116 6:127150665-127150687 CTTGGGCTGAGATCTCTTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014916116 Original CRISPR CTTGGGCTGAGATCTCTTAA AGG Intronic
904724331 1:32535454-32535476 CCTGGGCTGGGATCACTTGAAGG - Intronic
908109991 1:60887284-60887306 CTTGTGCTGAGCTCTCTGATTGG - Intronic
908146621 1:61252977-61252999 CTTGGGATGAGATGTGTAAAGGG + Intronic
915545309 1:156593722-156593744 CTTGGGCCGTGGTCTCTTCATGG - Intronic
915612725 1:157007481-157007503 CTTAGGCTGAGATTTATAAAAGG + Intronic
916911810 1:169357619-169357641 CATGCACTGAGATCTCTAAAAGG - Intronic
918454265 1:184691382-184691404 CTTGCTCTAATATCTCTTAAAGG + Exonic
923125920 1:231034350-231034372 TTTGGGCTAAAATCTCTTATTGG - Intronic
1070588347 10:77782800-77782822 CTTGGGCTGATCTGTCATAATGG - Intergenic
1070617388 10:77979380-77979402 CTTGGGGTGAGAGCTGGTAAGGG - Intronic
1072845420 10:98825234-98825256 CTTGAGCTGAGCTTTCCTAAAGG + Intronic
1077744109 11:4881291-4881313 CTTGGAATGATATCTCATAAAGG - Intronic
1080723360 11:34870814-34870836 CTGCAGCTGAGATCTCTGAATGG + Intronic
1082875043 11:57979502-57979524 CTTGAGCTGAGATTTATTACAGG + Intergenic
1085466670 11:76728672-76728694 CTTGGCCTGAGACCTTCTAATGG - Intergenic
1086179664 11:83935326-83935348 CCTGGGCTAATAGCTCTTAAGGG + Intronic
1089084259 11:115803399-115803421 CATGGGCTGAGCCCTCTCAAAGG - Intergenic
1089632924 11:119794623-119794645 CTTGGGGTGAGCTCTCTTGGGGG - Intergenic
1089846545 11:121463065-121463087 CTTGGGGTGCGCTCTCTTGAGGG + Intronic
1090329478 11:125919752-125919774 CCTAGGCTGTGAGCTCTTAAGGG - Intronic
1094799241 12:34012011-34012033 CTTGTGCTGATATCTCTAAATGG + Intergenic
1095112024 12:38306285-38306307 CTTGTGCTGATATCTCTAAATGG + Intergenic
1097720739 12:63017964-63017986 CTAGGGCTTAGATCTCATAGAGG - Intergenic
1100148226 12:91703381-91703403 ATTGGGCAAAGATCTCTTTAAGG - Intergenic
1101573332 12:105975277-105975299 CTTAGGCTGTGAGCTCTTTAAGG - Intergenic
1103051104 12:117780546-117780568 CAGGGGCTGAGATTACTTAATGG + Intronic
1106423976 13:29608119-29608141 CTTTGGTTGAGGTCTCTTTAAGG + Intergenic
1110211211 13:72975562-72975584 ATTGGAGTGAGTTCTCTTAAAGG + Intronic
1111727901 13:92035823-92035845 CTTGAGCTCAGATCTCTGCAGGG - Intronic
1112011970 13:95300738-95300760 CTTTGGCTGAGATCAGATAAAGG + Intronic
1113919967 13:113901731-113901753 CTTGGGTTGGGAGCTCCTAAAGG + Intergenic
1115069153 14:29300423-29300445 CCTGCACTGAGTTCTCTTAATGG + Intergenic
1115275709 14:31606391-31606413 CTGGAACTGAGATTTCTTAAAGG + Intronic
1118498559 14:66333719-66333741 CTTTGGTTGGGATCTCTGAATGG - Intergenic
1125767600 15:42145814-42145836 CTTCGGCTCAGAACTCTTCATGG - Exonic
1126532691 15:49728316-49728338 AGTGGGCTGAGATCTTTAAAAGG + Intergenic
1128445297 15:67754462-67754484 CTTGGGCTGTGATCTCTGCCAGG + Intronic
1129276856 15:74451258-74451280 GTGGGACTGAGAGCTCTTAAAGG + Intronic
1130547576 15:84868196-84868218 CTGGGGCTGACACCTCTCAAGGG + Exonic
1131613566 15:93989865-93989887 CTTGGGCTGGGATGACTTGAAGG + Intergenic
1138361014 16:56426960-56426982 TCTGGGCTGAGAACTCTTACAGG - Intergenic
1140843000 16:78859245-78859267 CTTGGGCTGAGCTGCCTGAAAGG + Intronic
1143339238 17:6196146-6196168 TTTGGGCTCAGATCAGTTAAGGG + Intergenic
1150240878 17:63631585-63631607 AATGGGCAAAGATCTCTTAAAGG + Intronic
1150337707 17:64342501-64342523 CTGGGACTGAGAACTCTTACAGG + Intronic
1151413984 17:73949604-73949626 GTTGGGCTGTGAACTCTTGAAGG - Intergenic
1152472898 17:80500135-80500157 CTGGGGCTCAGATCCCTGAATGG - Intergenic
1154111789 18:11575749-11575771 CTGGGGCTGAGTTCTTTTAGTGG - Intergenic
1156599202 18:38584405-38584427 CTTGGTTGGAGATCTCTTATTGG - Intergenic
1157492167 18:48131197-48131219 CCTGGCCTGAAATCTTTTAAAGG + Intronic
1159050106 18:63413802-63413824 ACTGGGCTGAGATCTGTAAATGG + Intronic
1160267979 18:77357142-77357164 CTGGGGATGAGATCCATTAATGG - Intergenic
1160423360 18:78764546-78764568 GTAGGGCAGAGATCTCTTTATGG - Intergenic
1163470867 19:17496328-17496350 CTGGAGATGAGAACTCTTAAAGG + Intronic
1166417687 19:42608430-42608452 GTTGGGATGAGATTTCATAATGG + Intronic
928175941 2:29034439-29034461 CTTGGTCTGTGAGCTCCTAACGG + Intronic
929290881 2:40189796-40189818 CTTGGGCTTAGCTCTTTTAGAGG + Intronic
929398017 2:41545772-41545794 CCTGGCTTGAGATATCTTAAGGG - Intergenic
930011261 2:46940410-46940432 CTTGGGGGGAGACCTCTTACAGG - Intronic
932385972 2:71332633-71332655 CTTGGGCCCCGTTCTCTTAAAGG + Intronic
932998766 2:76893649-76893671 CTTAGGATGAGTTCTCTTTAAGG - Intronic
935622167 2:105139734-105139756 CCTGGGCTGAGATGCCTCAAAGG + Intergenic
935640527 2:105285767-105285789 CTTTGTCTGACATCTCTAAAGGG - Intronic
936979200 2:118248743-118248765 CTTAGGCTGGGAACTCCTAAAGG + Intergenic
938019133 2:127891879-127891901 CTGCTGCTGAGAACTCTTAAGGG + Intergenic
939252940 2:139706234-139706256 CATGGGCTGAAATCCCGTAAGGG - Intergenic
1173056527 20:39619009-39619031 TTTGGGCTTAGATGTATTAAGGG + Intergenic
1178041854 21:28648056-28648078 CAGAGGCTGAGATTTCTTAATGG + Intergenic
950041741 3:9924102-9924124 CTTGGGGTGAGTCCTCTTCAAGG - Intronic
950242234 3:11381193-11381215 CTTGAGCAGATATATCTTAAAGG - Intronic
953627562 3:44583563-44583585 CTTTAGCTGTGATCTCTTCACGG + Intronic
954906673 3:54069133-54069155 CTTGGGGAGAGATTTGTTAAAGG - Intergenic
959295602 3:104530940-104530962 CTAGGGCTAAAATCTCTTATGGG - Intergenic
960156409 3:114301144-114301166 CCTGGGCTGAGCTGACTTAAAGG - Intronic
966317333 3:178662783-178662805 CTTATGCTAAGATCTCTAAATGG + Intronic
972370794 4:38421337-38421359 CTTGGGCTGAGACCAGCTAATGG - Intergenic
978240218 4:106506201-106506223 CTTGTGCTAAGTTCCCTTAAAGG + Intergenic
979294980 4:119021927-119021949 CTTGGTCTTTGATCTCTTACTGG + Intronic
982391396 4:154868112-154868134 GTTTGGCTGAGAAGTCTTAATGG - Intergenic
982849524 4:160295124-160295146 CTGAGGCTAAGATCTCTCAAAGG + Intergenic
987651777 5:20750296-20750318 GTTGAGCTGAGAATTCTTAATGG - Intergenic
988210026 5:28191996-28192018 CTTGGGGTTAGAGCTTTTAATGG - Intergenic
988743785 5:34111183-34111205 GTTGAGCTGAGAATTCTTAATGG + Intronic
989264403 5:39456279-39456301 CTTGGTTTGAGATCTCTTGTTGG + Intronic
990273324 5:54169684-54169706 CTTGGGTTAGAATCTCTTAAGGG - Intronic
990898708 5:60727463-60727485 CTTGGGCTGAGATGACTTGAAGG - Intergenic
992128665 5:73668523-73668545 CAAGGGCAGAGACCTCTTAAAGG + Intronic
994760882 5:103852291-103852313 CTTGAGATGGAATCTCTTAATGG - Intergenic
996502937 5:124236915-124236937 ATTGCCCTGAGATCTCTTTATGG + Intergenic
999243110 5:150138809-150138831 CTTTGGCTGAGATCTCTAGCAGG - Intronic
999792140 5:154950574-154950596 CTTGGGTTAATATCTATTAACGG + Intronic
1004837566 6:19545134-19545156 ATTGTGCTCAGATCTTTTAAAGG - Intergenic
1005495558 6:26384853-26384875 CTTGGGCTGAGAACCCTTCTGGG - Intronic
1005926912 6:30452164-30452186 CTTGGGCTCAGCTCTCCTCAGGG - Intergenic
1006573220 6:35022550-35022572 CTTAGGCTGAGCTCTTTTAAAGG - Intronic
1008815713 6:55562906-55562928 CTTGGAGTTAGAGCTCTTAAGGG - Intronic
1008865527 6:56204958-56204980 CTTTGGATGGGATCTCTGAATGG - Intronic
1009576373 6:65466881-65466903 CTGGGTCAGAGAGCTCTTAAGGG + Intronic
1010435910 6:75830791-75830813 CCTGGGCAGACATCTCTTAGAGG - Intronic
1011021479 6:82818275-82818297 TTTGGGCTGAGATTTCTTAGGGG + Intergenic
1011920760 6:92574784-92574806 CTTGTGCAGAAAGCTCTTAATGG + Intergenic
1012906976 6:105078659-105078681 CTAGGGCAGAGATCTCAGAACGG + Exonic
1012990994 6:105925784-105925806 CCTGGGCTGAAATCTCCTGAAGG + Intergenic
1013181394 6:107719579-107719601 GATGGGCTGTGATCTGTTAAGGG + Intronic
1014637742 6:123869415-123869437 CATGGGCTGAGAGCTCTTGAAGG - Intronic
1014916116 6:127150665-127150687 CTTGGGCTGAGATCTCTTAAAGG + Intronic
1016481814 6:144490076-144490098 CATGGGCTGAGATCTCTGCTTGG - Exonic
1019759934 7:2803446-2803468 CTTGGGGTGAGAGCACTTAGGGG - Intronic
1020333514 7:7043108-7043130 CTTGGGATGAGGTCTCTGAGTGG - Intergenic
1020611557 7:10403894-10403916 CTTGGTCTGGGATTTCTAAAAGG + Intergenic
1024889081 7:54180642-54180664 CTTGGTTTGAGGTCTCTGAATGG + Intergenic
1024972542 7:55084085-55084107 CTTGGGCTTACATCTCATCATGG - Intronic
1026463179 7:70632338-70632360 CGTGGGCTGAGATTTCACAAAGG + Intronic
1030415067 7:109232729-109232751 CTTGGGCTGTTCTCTCTTGATGG + Intergenic
1031698952 7:124900149-124900171 CTTGGGATGAGATCACTGAAGGG - Intronic
1031754289 7:125618483-125618505 CTTGTGCTCAGACCTCTCAATGG + Intergenic
1034013191 7:147553313-147553335 CTTGTCCTGAGATCATTTAATGG - Intronic
1034252119 7:149701104-149701126 CTAGGTCTGAGCTCCCTTAAGGG + Intergenic
1034679984 7:152921241-152921263 CTTTGGCTGAGATCCCTAGAAGG + Intergenic
1037613267 8:20494678-20494700 CCTGGGCTGAGGTGTCTCAAGGG - Intergenic
1039060095 8:33566318-33566340 CTCGGGCTGGGATCTCCTAGAGG - Intronic
1040874047 8:52131674-52131696 CTTAGGCTGCTATTTCTTAACGG - Intronic
1041765520 8:61414449-61414471 ATTGAGCTGAGATTTTTTAATGG + Intronic
1043173724 8:76998233-76998255 CTAGGACTGAGCTCTTTTAATGG + Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049244969 8:141557522-141557544 CTTGGGCTGAGAACTCCCACTGG + Intergenic
1051358781 9:16263735-16263757 GATGTGCTGAGATCTCCTAATGG - Intronic
1052552330 9:29968202-29968224 CTTGGGATGATGTCTCTTTAGGG - Intergenic
1057193139 9:93098331-93098353 CCTGGGCTGAGATGTCTTGTGGG + Intronic
1186685739 X:11922818-11922840 CTAGGGCTAAGGTCTCTTATGGG - Intergenic
1192988283 X:76424088-76424110 CTGGGTCAGAGATCTCTGAAGGG - Intergenic
1193258631 X:79379681-79379703 CTGGGGCTAAGATGTTTTAATGG - Intergenic
1202050942 Y:20780131-20780153 CTTGCTCTGAGATCTTTTGAGGG + Intronic