ID: 1014928141

View in Genome Browser
Species Human (GRCh38)
Location 6:127299327-127299349
Sequence CAGTGGGGTAAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 9, 3: 42, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014928133_1014928141 -8 Left 1014928133 6:127299312-127299334 CCCCTGAAGATGTTCCAGTGGGG 0: 1
1: 2
2: 32
3: 336
4: 606
Right 1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG 0: 1
1: 1
2: 9
3: 42
4: 293
1014928135_1014928141 -9 Left 1014928135 6:127299313-127299335 CCCTGAAGATGTTCCAGTGGGGT 0: 1
1: 1
2: 6
3: 83
4: 552
Right 1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG 0: 1
1: 1
2: 9
3: 42
4: 293
1014928136_1014928141 -10 Left 1014928136 6:127299314-127299336 CCTGAAGATGTTCCAGTGGGGTA 0: 1
1: 1
2: 5
3: 70
4: 559
Right 1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG 0: 1
1: 1
2: 9
3: 42
4: 293
1014928130_1014928141 7 Left 1014928130 6:127299297-127299319 CCATGCATGTTACTGCCCCTGAA 0: 21
1: 128
2: 287
3: 390
4: 503
Right 1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG 0: 1
1: 1
2: 9
3: 42
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014928141 Original CRISPR CAGTGGGGTAAGATGTGGAG GGG Intronic
900707754 1:4090922-4090944 TAGGTGGGTAAGAGGTGGAGGGG + Intergenic
901788273 1:11638986-11639008 CAGTGGGGCAGGGTGTAGAGAGG - Intergenic
901911556 1:12462907-12462929 CATTGGGCTGAGATGAGGAGTGG - Intronic
903183568 1:21617515-21617537 CAGTGGGGTACAGTGTGGGGTGG - Intronic
904301823 1:29559213-29559235 CAGTGCGGTAGGAGGTGGATAGG + Intergenic
904666753 1:32128228-32128250 AAGGGAGGTAAGAGGTGGAGGGG - Intronic
908326962 1:63032359-63032381 CAGTGGGGCAAGACGTTGGGTGG - Intergenic
908680541 1:66656210-66656232 CAGTGGGATAAAAGGTGGAGGGG - Intronic
908806070 1:67934095-67934117 CAGTGGGACAAAATGTGGAGGGG + Intergenic
908817349 1:68047860-68047882 CAGTGGTGTGGGATGTAGAGAGG + Intronic
909235502 1:73148323-73148345 CAGCAGGGTAAGAAGTGGAAAGG - Intergenic
909502182 1:76346615-76346637 CAGTGGGGTATGGTGTGTGGTGG + Intronic
911445631 1:97988147-97988169 CTGTGGGGTAAGAGGGAGAGAGG + Intergenic
915506957 1:156363737-156363759 CAGTGTGACAAGATGTGGAGGGG - Intronic
916445005 1:164864118-164864140 AAGTGTGGTGAGTTGTGGAGGGG + Intronic
916833188 1:168514002-168514024 CATTGGGGTAGAATGTGCAGTGG - Intergenic
916933578 1:169604832-169604854 CAGCAGGGGTAGATGTGGAGGGG + Intronic
917014321 1:170512154-170512176 CAGTGTGATAGGATTTGGAGAGG + Intergenic
917651782 1:177084880-177084902 CAGTGGGTTAAGAAGTGAATGGG - Intronic
918272826 1:182919896-182919918 CAGTGGGGGATGATGTGGTAGGG - Intronic
918818001 1:189214860-189214882 CAATGGGACAAGATGTGGAGGGG + Intergenic
920178302 1:204117011-204117033 CAGTGGGGCAAGCCATGGAGTGG - Intronic
921035880 1:211377674-211377696 CACTGGGGAGAGAAGTGGAGAGG - Intergenic
921364707 1:214362708-214362730 GAATGGGGAAAGAAGTGGAGTGG + Intronic
924167511 1:241300197-241300219 TAGTGGGGTAGGTTGGGGAGGGG - Intronic
924279161 1:242418754-242418776 CTATGGGGTATGATGTGGTGTGG - Intronic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1063218903 10:3948348-3948370 CAGTCCGGTGGGATGTGGAGAGG + Intergenic
1065593835 10:27293433-27293455 GAGTGGGGTAAAATGTTGAAAGG + Intergenic
1065656513 10:27956831-27956853 GAGTGGGGTAAAATGTTGAAAGG - Intronic
1066007931 10:31165327-31165349 CAACTGGGTAAGATGTGCAGTGG + Intergenic
1068152690 10:53154330-53154352 CAGTGGGACAAGATGTGGAGGGG + Intergenic
1069722936 10:70561123-70561145 CTCTGGGGTAAGAGGTGGAGTGG - Intronic
1070765113 10:79051953-79051975 GAGTGGGTTGGGATGTGGAGGGG + Intergenic
1071339617 10:84632291-84632313 CAGTGGGACAAGACATGGAGGGG + Intergenic
1071371987 10:84961118-84961140 CAGTGGGGGAAGGTGAGGAGGGG - Intergenic
1072711301 10:97717322-97717344 CAGTAGGGGGAGATGGGGAGAGG + Exonic
1073084962 10:100882435-100882457 CAGTGAGGGAAGAGGAGGAGAGG + Intergenic
1073091118 10:100940740-100940762 AAGTGGGGGAAGATGGGGAAGGG - Intronic
1073788423 10:106915466-106915488 CAGTGGAGTGGGATGAGGAGGGG - Intronic
1074585186 10:114761589-114761611 CAGTGGTGAGAGATGTGCAGTGG - Intergenic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1078378599 11:10818701-10818723 CAGTGGAGAAAGAAGAGGAGGGG - Intronic
1079637432 11:22761429-22761451 CAGTGGGGTCACATGTTGTGAGG + Intronic
1081749122 11:45495210-45495232 CTGGGGGGTGAGATGTGAAGGGG - Intergenic
1082123771 11:48408293-48408315 CACTGGGGACAGTTGTGGAGTGG + Intergenic
1082279640 11:50257930-50257952 CTGTGGGGTGTGATGTGGGGTGG - Intergenic
1082852278 11:57776029-57776051 GAGCGGGGTAAGTTGTGGAAAGG + Intronic
1083072912 11:60005167-60005189 CAGTGGGACAATATGTGGAGAGG + Intergenic
1083625403 11:64069577-64069599 CTGTGGGGCCAGGTGTGGAGGGG + Intronic
1085036832 11:73305933-73305955 CTGTGGGGTGAGTTGTGGAGGGG - Intergenic
1087114114 11:94505337-94505359 CAGCAGGACAAGATGTGGAGGGG + Intergenic
1087117079 11:94537019-94537041 CAGTGGTGGAAGATGAAGAGTGG + Intergenic
1087966269 11:104420153-104420175 CAGTGGAGGAAAATGTGGATAGG - Intergenic
1088799964 11:113296667-113296689 CAGTGTGGGCAGATGGGGAGGGG + Intergenic
1089059569 11:115615420-115615442 AAGTGGGGAGAGATGTGGATTGG - Intergenic
1089194698 11:116687414-116687436 CAGTGGGGCAGGATGATGAGGGG - Intergenic
1089781801 11:120878452-120878474 GATGGGGGTAGGATGTGGAGAGG - Intronic
1090258553 11:125302797-125302819 TAGTGGGAAAAGACGTGGAGAGG - Intronic
1091647399 12:2284207-2284229 GAGTGGGGTAAGCTGGGGAGAGG + Intronic
1092539076 12:9408575-9408597 CAGGAGGGGAAGATGGGGAGAGG - Intergenic
1092634311 12:10425087-10425109 CAGTGGGACAAGATGTGGAGGGG - Intronic
1092635357 12:10440492-10440514 CAGTGGGACAAGATGTGGAGGGG - Intronic
1093785105 12:23183851-23183873 TAGTTGGGTAAGAGGTTGAGGGG - Intergenic
1094434290 12:30404025-30404047 CACAGGGGTCAGATATGGAGGGG - Intergenic
1095982610 12:47981735-47981757 CAGGGAGGCAAGGTGTGGAGAGG + Intronic
1096826412 12:54281496-54281518 CTGTGTGGTAAGATTTGGAAGGG + Exonic
1097107374 12:56633706-56633728 AAGTGGGGGAAGAAGGGGAGGGG - Intronic
1097180518 12:57169113-57169135 CGGTGGGGGAAGAAGGGGAGAGG - Intronic
1097734323 12:63165407-63165429 CAGTGGGGGAAGATCTGGAGAGG - Intergenic
1101967102 12:109289028-109289050 CAGTGGGGAAAGAAGAGGAGAGG + Intronic
1103326906 12:120127801-120127823 CATTGAGCAAAGATGTGGAGCGG + Exonic
1103927643 12:124432740-124432762 CACTGTGGTTAGATGTGGAGAGG - Intronic
1104815156 12:131641439-131641461 CGGTGGGATAAGATAGGGAGGGG - Intergenic
1104869962 12:131987948-131987970 CAGTGGTGTAAGTGGTGGGGAGG + Intronic
1104965316 12:132506370-132506392 CAATGGGGAGAGGTGTGGAGCGG + Intronic
1105643732 13:22294105-22294127 TAGTGGGGAAAGCTGTTGAGGGG - Intergenic
1105846513 13:24298674-24298696 CAGTGGGCAAGGATGGGGAGGGG - Intronic
1107361101 13:39618656-39618678 CAGTGTGGGGAGATGGGGAGGGG + Intergenic
1109889722 13:68593898-68593920 CAGTGAGACAAGATGTGGAATGG + Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1112435415 13:99388497-99388519 GAGTGGAGGAAGAGGTGGAGAGG + Intergenic
1113299573 13:109003155-109003177 CAGTGGAGAGTGATGTGGAGTGG - Intronic
1113389509 13:109882113-109882135 GCCTGGGGTAAAATGTGGAGCGG - Intergenic
1114856869 14:26457832-26457854 CAGTAGGACAAGATGTGGACAGG + Intronic
1115029263 14:28774838-28774860 GAGTGGGGTAACAAGTGGAGAGG - Intronic
1116590518 14:46765562-46765584 TAGTGGGACAAGATGTGGAGTGG - Intergenic
1116655065 14:47642056-47642078 AAGTGGGGTAAAATAAGGAGGGG + Intronic
1117619370 14:57568793-57568815 CATTGTGGGAAAATGTGGAGTGG + Intronic
1117620231 14:57578372-57578394 CAGTGGGATGACATCTGGAGGGG + Intronic
1119038213 14:71248374-71248396 CAGTTGGGTAAGAGCTGGAAAGG - Intergenic
1119679911 14:76584601-76584623 CAGAGGGGGAAGAGGTGGAGGGG + Intergenic
1120329926 14:83079264-83079286 CAGTGGGCCCAGGTGTGGAGAGG + Intergenic
1120929244 14:89831911-89831933 AAGTGGTCTAAGATATGGAGCGG + Intronic
1121413550 14:93763636-93763658 CAGTGGGGGTGGATGTGGGGTGG + Intronic
1122378057 14:101280697-101280719 CAGTGAGGTAAGATGGGAGGTGG - Intergenic
1123966751 15:25467173-25467195 CAGTGGTGTGGCATGTGGAGCGG + Intergenic
1124529476 15:30491909-30491931 CAGTGGGGGAAGCTGTGTATGGG + Intergenic
1124896856 15:33785523-33785545 CAGTGAGCTTGGATGTGGAGTGG - Intronic
1125322595 15:38504531-38504553 CAATAGGATAAGATGTGGAGTGG - Intronic
1125436765 15:39654023-39654045 CAGTGGGACAAGATGTAGAGTGG - Intronic
1125444156 15:39735912-39735934 CAGTGGGACAAGATATGGAGTGG - Intronic
1125519854 15:40341876-40341898 CAGTGGGTCAATATGTGGAATGG + Intergenic
1129617956 15:77114749-77114771 TAGTGGGATAAGATGAGGTGGGG + Exonic
1130989898 15:88870046-88870068 CAGTCTGGAAAGAGGTGGAGAGG - Intronic
1131467481 15:92667460-92667482 CAGTGGGGACAGGTATGGAGAGG - Intronic
1132690872 16:1181290-1181312 CAGTGGAGTGGGAGGTGGAGGGG - Intronic
1133028301 16:2998050-2998072 CAGTGGGGGAAGGGGTGGGGTGG + Intergenic
1134392326 16:13831189-13831211 CAGTGGGCTCTGAGGTGGAGGGG - Intergenic
1137364338 16:47847773-47847795 CAGTGGCGTGAGCTGGGGAGGGG + Intergenic
1138519090 16:57560572-57560594 GAGTGGGGGAGGATGTGGGGAGG + Intronic
1140268316 16:73439884-73439906 CAGTGGGGCAGGAAGGGGAGAGG + Intergenic
1141437435 16:84008342-84008364 AAGGAGGGTAGGATGTGGAGAGG - Intergenic
1141808506 16:86358043-86358065 CAGTGGGGGAAGGGGTGGTGGGG - Intergenic
1141897648 16:86968851-86968873 CAGGGGGGTCAGTTGTGGGGTGG - Intergenic
1142887899 17:2924597-2924619 CAGTGGCATTAGAGGTGGAGGGG + Intronic
1143623767 17:8096344-8096366 AAGTGGGGCAAGAAGTGAAGCGG + Intronic
1143773780 17:9184773-9184795 AAATGGGGAAAAATGTGGAGGGG + Intronic
1145884130 17:28371201-28371223 CAGTGGAGTCAGCTGTGGAATGG + Intronic
1146581304 17:34040431-34040453 CAGTGGGGGAGGAGGGGGAGGGG + Intronic
1147166031 17:38593916-38593938 GAGTGGAATAAGATGTGGATGGG - Intronic
1147381285 17:40057721-40057743 GAGTGGGGTAAGAGGTGGCAAGG + Intronic
1148229007 17:45919550-45919572 CAGTGGGGGAAGGTAGGGAGGGG - Intronic
1149361341 17:55898865-55898887 CAGTGGGGTATGATATGGTTTGG + Intergenic
1151406450 17:73890224-73890246 GTGTGGTGTAAGTTGTGGAGGGG + Intergenic
1151715685 17:75829977-75829999 CAGTGGGGAGAGATGAGGGGAGG + Intronic
1151772813 17:76176633-76176655 CAGGGCGGCAAGCTGTGGAGGGG - Intronic
1152253413 17:79223611-79223633 CAGTGGCGTGAGACATGGAGAGG + Intronic
1152457963 17:80426927-80426949 CGGTGGGGTAAGATGGGGAAGGG - Intronic
1152589673 17:81205376-81205398 CAGTGGGGTAGGAGGGGCAGCGG + Intronic
1153263382 18:3245737-3245759 CAGTGGGGAAAGAAAAGGAGAGG - Intergenic
1154353643 18:13608315-13608337 CGGTGGGGCAGGCTGTGGAGGGG + Intronic
1154959618 18:21295301-21295323 CTTTAGGTTAAGATGTGGAGAGG - Intronic
1156349969 18:36295694-36295716 CAGTGGAGTAAGAGGCTGAGGGG + Intergenic
1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG + Intergenic
1156570608 18:38248189-38248211 CATAGGGACAAGATGTGGAGGGG + Intergenic
1157568389 18:48696092-48696114 CAGCTGGGGAAGAAGTGGAGAGG - Intronic
1157711192 18:49850829-49850851 CAGTGGGGTTGGATCTGGACAGG - Intronic
1158221915 18:55159342-55159364 CAGAGGGGTGAGATGGGGGGCGG - Intergenic
1161102898 19:2430130-2430152 CAGGGAGGGGAGATGTGGAGGGG - Exonic
1161489545 19:4554353-4554375 CAGTGGGGCATGAAGTTGAGAGG - Intronic
1162404948 19:10467981-10468003 CAGTGGGGGAAGGTGAGGGGAGG - Exonic
1163716395 19:18874817-18874839 CAATGGGGTGAGATGGGGTGAGG + Intronic
1164673565 19:30087469-30087491 CACTGGGGTAAGATGGACAGCGG + Intergenic
1165170869 19:33890733-33890755 CAGTGGGGTAGGGGGTGGGGAGG - Intergenic
1167006961 19:46782523-46782545 CCGTGGGGCAGGAGGTGGAGGGG - Exonic
1168133551 19:54336471-54336493 CAGTAGGGTAAAGAGTGGAGAGG - Intronic
1168557035 19:57351822-57351844 CAGTGGCATAAGGTGTGGAACGG + Intronic
925726561 2:6878193-6878215 CAGTGGGGTAAGGCGAGAAGGGG + Intronic
925872907 2:8286128-8286150 CAGTGGGGTCAGATGAGGTGAGG - Intergenic
926238424 2:11067457-11067479 AAGTGGGGGAAGATGGGGTGGGG - Intergenic
926311529 2:11679256-11679278 GAGTGGTGGAAGATGGGGAGAGG + Intronic
927044460 2:19262989-19263011 CATTGGGGAAAGAAGTGGAAGGG - Intergenic
927266765 2:21161237-21161259 GACTGGAGTCAGATGTGGAGTGG + Intergenic
927681078 2:25139436-25139458 CAGAGGGGCAGGAAGTGGAGGGG - Intronic
928170814 2:29001959-29001981 CTGTGGGGTGAGATGGGGTGGGG + Intronic
929084427 2:38154378-38154400 AAGTGGGGTAGGATGAGGACTGG + Intergenic
929575850 2:43051198-43051220 CAGTGGTGTAGGATGGGAAGAGG + Intergenic
931101383 2:59005358-59005380 CACTGTGGTCAGATGTGGATAGG + Intergenic
931517256 2:63057271-63057293 CAGAGGGAGAAGATGTGAAGAGG - Exonic
936965327 2:118122378-118122400 CAGAGAGGTGGGATGTGGAGGGG - Intergenic
937071125 2:119064336-119064358 GAGTGGGGTGAGGAGTGGAGAGG - Intergenic
937475647 2:122212816-122212838 CTGTGGTTTAAGCTGTGGAGAGG + Intergenic
937727966 2:125189482-125189504 GAGTGGGGTAAGCTGTAAAGAGG + Intergenic
937956016 2:127422224-127422246 CACTGGGGAAAGAGGTGGTGGGG - Intronic
938881564 2:135594804-135594826 CAGTAAGGAAAGATGGGGAGAGG - Intronic
939293378 2:140223534-140223556 CTGTGGGGCAAGAGGTGGTGAGG + Intergenic
941875851 2:170432271-170432293 CAGTGGGATAAGATGTGTGGAGG + Intronic
942455357 2:176134673-176134695 TATTTGGGTAAGATGGGGAGAGG + Intergenic
942819168 2:180090606-180090628 CAGTGGGATAAGATGTGAAGGGG + Intergenic
944317522 2:198299096-198299118 CAGTGGGAGAAGATATGGAGGGG + Intronic
944535538 2:200705894-200705916 GTTTGGGGTGAGATGTGGAGGGG - Intergenic
944892886 2:204135758-204135780 CAGTGGGCAAAGTTGGGGAGTGG + Intergenic
944986114 2:205179025-205179047 CAGTGGGATAAGATATGAAGGGG + Intronic
945614784 2:212054068-212054090 CTGTGGGGCAAGAGGAGGAGGGG - Intronic
945723923 2:213451936-213451958 GAGTGGGGTGAGATGGGGTGGGG - Intronic
947263575 2:228251963-228251985 CAGTGGGGGAAGAGGTGGTAAGG + Intergenic
948887380 2:240891041-240891063 CAGTGGTGTCAGATCTGGATGGG + Intronic
1168806016 20:672772-672794 GAGGGGGGGAAGATGAGGAGAGG - Intronic
1170754017 20:19181614-19181636 CAGTGGGGTGAGATGCTTAGGGG - Intergenic
1170865263 20:20149907-20149929 CAGTGTGGGGAGATGAGGAGGGG + Intronic
1171031180 20:21677673-21677695 AAGTTGAGTAAGGTGTGGAGTGG - Intergenic
1171216592 20:23356866-23356888 CAGTGGGGTAGGAGGTGGGCAGG + Intergenic
1171736164 20:28788470-28788492 CACTGGGGACAGATGTGGGGTGG - Intergenic
1175042393 20:56066688-56066710 CACTGGGGCAAGTTGTGGGGTGG - Intergenic
1175582207 20:60108908-60108930 CAGTGGGACAAGGTGTGGGGTGG + Intergenic
1175920604 20:62448980-62449002 CAGAGGGGTCAGAGGTGGTGGGG + Intergenic
1177063118 21:16397435-16397457 CAGTGTGGGAAGAAGGGGAGAGG + Intergenic
1178824521 21:36004755-36004777 CAGTGGGGGAGGAGGTGGGGGGG + Intergenic
1182424815 22:30266412-30266434 AAGTGGTGTGAGGTGTGGAGGGG - Intronic
1183807052 22:40220397-40220419 CAATGGGGTGGGATGTGGAGGGG - Intronic
1183834438 22:40440648-40440670 CACTGGGGTTTGAGGTGGAGAGG + Intronic
1184236556 22:43186275-43186297 CAGTGGGGAACGCTTTGGAGTGG + Intronic
1184569360 22:45311985-45312007 CAGTGGGGCAGGGTGGGGAGAGG + Intronic
1184636550 22:45836624-45836646 CACTGGGGTGAGATGGGGTGAGG + Intronic
1184938198 22:47740256-47740278 CAGTGAGGAATGATGGGGAGAGG - Intergenic
1203301332 22_KI270736v1_random:79184-79206 CAGAGTGGAATGATGTGGAGTGG + Intergenic
949356677 3:3188392-3188414 CAGTGAGTTAAGATATGAAGAGG - Intergenic
951099331 3:18668502-18668524 TAGTGGGGCAAGAAGAGGAGAGG - Intergenic
951611198 3:24494636-24494658 CAGCGGGGTGAGAGGAGGAGGGG - Intronic
954058485 3:48048920-48048942 CAGGGGGGTAGTAGGTGGAGGGG - Intronic
954808492 3:53233857-53233879 CAGTGGGCTAATATGGGTAGTGG - Intronic
955480273 3:59382856-59382878 CAGTGAGTTAAGATGTAAAGAGG - Intergenic
957162895 3:76633400-76633422 TTTTGGGGTAAAATGTGGAGAGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958790456 3:98645285-98645307 CAGTGTGGGCAGATGAGGAGGGG - Intergenic
959715197 3:109425126-109425148 CTCTGGGGTAAGGGGTGGAGGGG - Intergenic
960135928 3:114104933-114104955 CAGTGGGACAAGCTGTGGAGGGG + Intergenic
960958994 3:123055851-123055873 TAGAGGGAGAAGATGTGGAGTGG + Intergenic
961999190 3:131277425-131277447 CAATGGGGAAGGCTGTGGAGGGG - Intronic
963215132 3:142737653-142737675 CAGTGGAATAAAATGAGGAGTGG + Intronic
964371560 3:156005300-156005322 CCGAGGGGTAAGCTGTGGGGTGG + Intergenic
964516873 3:157520160-157520182 CAGTGAGTCAAGATGTGAAGAGG - Intronic
964548486 3:157860807-157860829 CAGTGAGGTAAGAGCTGGAAGGG + Intergenic
965164580 3:165179970-165179992 AAATAGGGTAAGATGTGGTGTGG - Intergenic
967194464 3:187014490-187014512 CACTGGGGTGAGGTGTGGGGAGG + Intronic
967266111 3:187693716-187693738 CAGTGGGGTAAGATGTTCCAGGG + Intergenic
967507556 3:190270342-190270364 CATTGGGGACAGTTGTGGAGTGG + Intergenic
969229701 4:5821450-5821472 CAGTGGAGTTAGAAGTGGAAGGG + Exonic
969850214 4:9950099-9950121 CTGTGGGGTCAGGTGTGGAGAGG - Intronic
972621510 4:40751501-40751523 CAGTGAGGGAGGATGGGGAGAGG + Intronic
974356864 4:60824174-60824196 CAGTGGGGAGGGGTGTGGAGGGG - Intergenic
974884702 4:67804267-67804289 CAGTGGTGGAAGATGTTGACAGG + Intergenic
976002908 4:80393020-80393042 CAGTGGGATGAGACTTGGAGAGG + Intronic
978615116 4:110586643-110586665 TGGTGGGGTAGGATGTGGTGGGG + Intergenic
979504030 4:121474248-121474270 CAGTGGGACAGGATGTGGAGGGG - Intergenic
979545492 4:121935316-121935338 GAGTAGGGTATGATGTGTAGGGG + Intronic
980484469 4:133437835-133437857 CAGTGGGGCAAGATGAGAAATGG + Intergenic
981811307 4:148778867-148778889 CAGTGGAACAAGATGTGGAAGGG - Intergenic
982756096 4:159220361-159220383 CAGTGGGGTGGGATGGGGTGGGG + Intronic
983784534 4:171715387-171715409 CACTGGGGGAAGTTGAGGAGGGG + Intergenic
985217989 4:187673279-187673301 CTATAGGGTAAGAGGTGGAGAGG + Intergenic
986178936 5:5375819-5375841 CAGAGCAGTAGGATGTGGAGGGG + Intergenic
987725037 5:21687232-21687254 CAATGGGACAAGATGTGGAGGGG + Intergenic
989062473 5:37423056-37423078 CAGTGTGGAAAGAAGTGAAGAGG + Intronic
990108870 5:52298096-52298118 CAGTGGGACAACATATGGAGGGG - Intergenic
992024433 5:72656656-72656678 CAGTGTGCAGAGATGTGGAGTGG - Intergenic
992501006 5:77343977-77343999 CAGTGGGACAAGATGTGGAGGGG - Intronic
993817658 5:92572237-92572259 CAGTGGGGTGAGATGAGGAGTGG - Intergenic
993894247 5:93512166-93512188 CAGTGGGACAAGATGTGGGATGG + Intergenic
994399118 5:99256938-99256960 CAGTGTGGGCAGATGGGGAGGGG - Intergenic
994788888 5:104199319-104199341 CTTTGGGACAAGATGTGGAGAGG - Intergenic
995044570 5:107630953-107630975 CAGCAGGACAAGATGTGGAGGGG - Intronic
998525657 5:142841093-142841115 GGGTGGGGTAAGATGAGGAAAGG - Intronic
999202096 5:149823761-149823783 CAGTGGAGTAGGGTGGGGAGAGG + Intronic
999262867 5:150248192-150248214 CAGAGGGCTAAGAGGTGGAGGGG - Intronic
1000840898 5:166216894-166216916 TTCTGGGGTGAGATGTGGAGGGG + Intergenic
1002326775 5:178414951-178414973 CAAGGGGGTATGAAGTGGAGTGG + Intronic
1002540887 5:179906271-179906293 CAGTGGGGAGAGATTGGGAGAGG + Intronic
1003196662 6:3920730-3920752 CAGTGGGTGAACATGTGGAGGGG + Intergenic
1003480912 6:6532230-6532252 CAGTGGGGTCTGGTATGGAGGGG - Intergenic
1003976253 6:11347140-11347162 CACTGGGGTACAAAGTGGAGAGG + Intronic
1004007420 6:11649907-11649929 CGGTGGGAGAAGATGTGGTGTGG + Intergenic
1005950274 6:30626582-30626604 CAGTGGGCCATGCTGTGGAGTGG - Intergenic
1006066375 6:31465231-31465253 TGGTGGGGTAAGATTTGGGGTGG - Intergenic
1006803582 6:36774698-36774720 CAGAGGGGAAAGAGGTGGGGCGG + Intronic
1007911115 6:45514850-45514872 CATTGGGTTTAGATGTTGAGAGG - Intronic
1007995593 6:46304605-46304627 AAGAGAGGAAAGATGTGGAGGGG + Intronic
1008627364 6:53330899-53330921 CAGTGGGACAAGATGTAGAAGGG - Intronic
1010878414 6:81138189-81138211 CAGTGGGGCATGATGGGAAGTGG - Intergenic
1011494267 6:87923185-87923207 CAGTGGGGTAGGAAGGAGAGAGG - Intergenic
1012010532 6:93778915-93778937 CAGTAGGGCAAGAGGTGAAGAGG - Intergenic
1012438867 6:99243544-99243566 TAGTGGGGTAGGAAGTAGAGGGG - Intergenic
1013173798 6:107660565-107660587 CAGTGGGGTGAGATGGTGTGTGG - Intergenic
1014142325 6:117958034-117958056 CAGTGGGACAAGATGTGGAGTGG + Intronic
1014158649 6:118140727-118140749 CAGTGGGACAAGATGTTGAAGGG + Intronic
1014536558 6:122620630-122620652 CGGTGAGGTAAGAGGTTGAGTGG + Intronic
1014704116 6:124725617-124725639 CAGTGGGGTAATATGCTGAAAGG + Intronic
1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG + Intronic
1015629323 6:135215657-135215679 CAGTGGGAGGGGATGTGGAGTGG - Intronic
1015820167 6:137252524-137252546 CAGGGGGATCAGATATGGAGGGG - Intergenic
1015898122 6:138036357-138036379 AGGTGGGGTAAGATGGGGTGGGG + Intergenic
1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG + Intronic
1016885868 6:148959091-148959113 CAGTGGGGTGTGATGTGCAAGGG + Intronic
1017151604 6:151285674-151285696 CATTTGGGTGAGTTGTGGAGGGG + Intronic
1017204811 6:151793276-151793298 CAGTGGGACAAGATGTGGAAGGG - Intronic
1019098943 6:169611769-169611791 CAGTGGGACCAGATGTGGAGGGG - Intronic
1019141679 6:169950929-169950951 AAATGTGGAAAGATGTGGAGGGG - Intergenic
1019193102 6:170265474-170265496 CAGTGAGACCAGATGTGGAGGGG - Intergenic
1020582194 7:10017253-10017275 CAGTGGTGTAAGCTGTCGATAGG - Intergenic
1021134041 7:16944175-16944197 CAGTGGTGTCAAATGTGGACTGG + Intergenic
1021487952 7:21187619-21187641 CAGTGGGATAGTATTTGGAGAGG + Intergenic
1021733418 7:23619147-23619169 CAGTGGGGGAGGTTTTGGAGTGG + Intronic
1021804089 7:24338016-24338038 CAGTGGGGAAGGATGAAGAGAGG + Intergenic
1022575930 7:31496900-31496922 CCTTGGGGTAATATGTGAAGTGG + Intergenic
1023929055 7:44693854-44693876 CAGTGGGGTAGGGGGAGGAGCGG - Exonic
1024442678 7:49438695-49438717 CAGTGTGGTATGATATGGATTGG - Intergenic
1025238554 7:57252084-57252106 CATTGGGGCAAGAGGAGGAGGGG + Intergenic
1025810018 7:64869758-64869780 CAGTCTGGTGAGATGTTGAGGGG - Intergenic
1027545784 7:79525908-79525930 CAGTGGGACAAGATATGGGGTGG - Intergenic
1027891843 7:83987707-83987729 TAGTGGGGTAAGTTGAAGAGAGG - Intronic
1028244506 7:88460976-88460998 CTTTGGGGTTAGATGTAGAGTGG + Intergenic
1028998959 7:97132678-97132700 CAGTGAGGTAGGATTGGGAGGGG + Intronic
1029675994 7:102069264-102069286 AAGTGGGGTGAGATTTTGAGGGG - Intronic
1035330974 7:158097234-158097256 CACTGGGGAAGGAGGTGGAGGGG + Intronic
1035585437 8:769357-769379 CAGTGTGGTCAGTTGTGAAGTGG + Intergenic
1036779177 8:11634042-11634064 CAGTGGAGTAGGAGGAGGAGAGG - Intergenic
1037195402 8:16182673-16182695 CAGTGGGAGAAGATATGGAGGGG - Intronic
1037459007 8:19090336-19090358 CAGTGGGACAGGATTTGGAGGGG + Intergenic
1039782266 8:40797200-40797222 TAGTGGAGTAGGATGTGGTGTGG - Intronic
1041300645 8:56407786-56407808 CAGAGGGGGAAGGGGTGGAGGGG + Intergenic
1042844311 8:73155177-73155199 CAGTGGTGTAATATGTGGTCTGG - Intergenic
1043398153 8:79858261-79858283 CAGTGTGGTTAGATGGAGAGAGG - Intergenic
1044723617 8:95174260-95174282 TAGTGGGGGAAGATGGGGGGTGG - Intergenic
1044820691 8:96153997-96154019 CAGTGGGCTGGGAAGTGGAGTGG + Intronic
1045182189 8:99796295-99796317 CAGTGGGCTAAGAAGTGAATGGG + Intronic
1045343394 8:101273655-101273677 CATAGAGGCAAGATGTGGAGGGG + Intergenic
1046032278 8:108797543-108797565 TAGTGGGGAAGGATGGGGAGGGG - Intergenic
1046842482 8:118875237-118875259 CAGAGGAGGAAGAGGTGGAGAGG - Intergenic
1046890013 8:119412570-119412592 CAGTGGGACAGGATGTGGAGTGG + Intergenic
1047401163 8:124548754-124548776 CAGTGGGGGCAGATGCAGAGAGG + Intronic
1047510963 8:125515116-125515138 GATTGGGGTGAGATGGGGAGGGG - Intergenic
1048195431 8:132328238-132328260 GAGTGGGGTGAGGTGTGTAGGGG - Intronic
1048548353 8:135407737-135407759 GGCTGGGGTAGGATGTGGAGGGG - Intergenic
1049701959 8:144019336-144019358 CAGTGGACTGAGATCTGGAGAGG + Intronic
1050019264 9:1266980-1267002 CAGTGGTGAAGGATGAGGAGAGG + Intergenic
1050397924 9:5219373-5219395 CAGTGGGGTAAAAAGTGGGAGGG + Intergenic
1051261690 9:15271126-15271148 CAGTTGGGCAGGATGGGGAGGGG + Intronic
1052025066 9:23565016-23565038 CAGCGAGGTCAGATGGGGAGAGG + Intergenic
1052573288 9:30257550-30257572 CAGTAGGGTGAGATGTGGCAGGG - Intergenic
1056242514 9:84662451-84662473 CAGTGGGACAAGATGTGGAGTGG - Intergenic
1057116359 9:92526138-92526160 CAGTGGGACAAGATATGGAGGGG + Intronic
1057408590 9:94796137-94796159 CAGTCAGGTAAGCTGGGGAGAGG + Intronic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1061040918 9:128139854-128139876 CAGGGGGGGAAGAGGCGGAGAGG + Intergenic
1062361625 9:136190945-136190967 CAGAGGGGTGAGGTGGGGAGCGG + Intergenic
1203344093 Un_KI270442v1:19260-19282 CAGAGTGGAAAGAGGTGGAGTGG + Intergenic
1186214519 X:7284446-7284468 CAGTGGGATGTGATGTGCAGGGG + Intronic
1186732050 X:12420460-12420482 AAGTGAGGTGAGAGGTGGAGGGG - Intronic
1187636624 X:21236955-21236977 CAGTTGGACAAGATCTGGAGAGG + Intergenic
1189307887 X:40000832-40000854 CAGTGGGGTAAGAAGGAGAGGGG + Intergenic
1189380559 X:40499766-40499788 CGGTGGGCAGAGATGTGGAGGGG - Intergenic
1189429264 X:40932662-40932684 CAGTGGGGCAAGAGGATGAGGGG - Intergenic
1189648626 X:43163615-43163637 CATTGGGGGAAGCTGTGGAGGGG + Intergenic
1191609110 X:63092409-63092431 CACTGGGGACAGATGTGGTGTGG - Intergenic
1191661313 X:63654434-63654456 CATTGGGACATGATGTGGAGTGG - Intronic
1191784576 X:64903726-64903748 CAGAGGGGGGAGATATGGAGGGG - Intergenic
1191801815 X:65089866-65089888 CAGTGGGAAAAGATGTTGAGGGG - Intergenic
1195519409 X:105813614-105813636 CAGTGGGGTGAGATGGGAGGAGG + Intergenic
1196898373 X:120359945-120359967 CAGTTGTGTAAGTTGTGGGGTGG - Intergenic
1197877945 X:131131428-131131450 CAGTGGGACAAAATGTGGAGGGG - Intergenic
1199810014 X:151339847-151339869 CAGTGGGCCAAAATGTGGACAGG + Intergenic
1200079785 X:153570555-153570577 TAGTGGGGTCAGCGGTGGAGTGG - Intronic
1200938291 Y:8757537-8757559 CAATAGGGTCAGATGGGGAGAGG - Intergenic
1200980636 Y:9260455-9260477 CAGTAAGGTAAGATGGGGTGAGG + Intergenic
1202025107 Y:20513200-20513222 CAGTGGAACAAGATGTGGAGGGG + Intergenic