ID: 1014930044

View in Genome Browser
Species Human (GRCh38)
Location 6:127324985-127325007
Sequence AGTAACTTGCTTCCAAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014930038_1014930044 5 Left 1014930038 6:127324957-127324979 CCTTCCCCCTTGAGTGTAGACTA 0: 1
1: 1
2: 3
3: 21
4: 128
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930042_1014930044 -2 Left 1014930042 6:127324964-127324986 CCTTGAGTGTAGACTAAACTTAG 0: 1
1: 0
2: 7
3: 44
4: 230
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930039_1014930044 1 Left 1014930039 6:127324961-127324983 CCCCCTTGAGTGTAGACTAAACT 0: 1
1: 0
2: 0
3: 15
4: 100
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930040_1014930044 0 Left 1014930040 6:127324962-127324984 CCCCTTGAGTGTAGACTAAACTT 0: 1
1: 1
2: 4
3: 45
4: 223
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930037_1014930044 6 Left 1014930037 6:127324956-127324978 CCCTTCCCCCTTGAGTGTAGACT 0: 1
1: 1
2: 1
3: 21
4: 187
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930036_1014930044 27 Left 1014930036 6:127324935-127324957 CCAGGAGATGGAATTTATTTTCC 0: 1
1: 0
2: 2
3: 29
4: 314
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193
1014930041_1014930044 -1 Left 1014930041 6:127324963-127324985 CCCTTGAGTGTAGACTAAACTTA 0: 1
1: 0
2: 7
3: 56
4: 244
Right 1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG 0: 1
1: 1
2: 1
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014930044 Original CRISPR AGTAACTTGCTTCCAAGGAG TGG Intronic
901489536 1:9589514-9589536 AGTAACTTGCTGTTAATGAGAGG + Intronic
901545206 1:9951162-9951184 AGTTACTTGCCTCGAAGGACTGG + Intronic
903342740 1:22664599-22664621 AGTATCCTGATTCCAAGCAGGGG - Intergenic
908062889 1:60371142-60371164 AGAAAATTGATACCAAGGAGTGG + Intergenic
912086713 1:106014965-106014987 AGAAAATTGGTACCAAGGAGTGG - Intergenic
913051573 1:115121155-115121177 AGAAAATTGGTACCAAGGAGTGG - Intergenic
917658801 1:177156709-177156731 AGTGACTTCCTTCAAAGGAATGG + Intronic
917794674 1:178524334-178524356 AGTGACTTGCTTCTAATGAATGG + Intronic
918723097 1:187879517-187879539 AGTCACTTGCATCCTGGGAGAGG + Intergenic
918749178 1:188249950-188249972 AGGAAATTGCTTCCAAAAAGGGG - Intergenic
920924744 1:210330516-210330538 TCTAACCTACTTCCAAGGAGGGG - Intronic
923148262 1:231212793-231212815 AGGAACATGCTCCCAAGGGGGGG - Intronic
923900031 1:238315857-238315879 AGTAAATTGCTTTAAAGCAGTGG + Intergenic
924718645 1:246602619-246602641 AGTAACCTGCTTCTAATGAAAGG - Intronic
1063333663 10:5187824-5187846 AATAACCTGCTTCCAAGGTCAGG - Intergenic
1063402997 10:5765830-5765852 ATTAACTTGTTTTCATGGAGTGG - Exonic
1066696009 10:38078237-38078259 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1070583177 10:77739584-77739606 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1070959356 10:80488018-80488040 AGAAACCAGCTTCCACGGAGTGG - Intronic
1075184665 10:120245033-120245055 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1075839278 10:125485751-125485773 AGTGACTTCCTTCCAAAGTGTGG + Intergenic
1076203040 10:128573156-128573178 AGGAGCTGGCTTCCTAGGAGGGG - Intergenic
1080908976 11:36575916-36575938 AGTTAATTCCTTCCGAGGAGAGG + Exonic
1082677799 11:56129905-56129927 AGTGACTTTCTTCAAAGGACTGG + Intergenic
1088629465 11:111760698-111760720 AGTACCTTGTTACCAATGAGTGG - Intronic
1089302514 11:117507293-117507315 AGTAGCAGGCTTCCAGGGAGGGG - Intronic
1089474731 11:118749805-118749827 AGTAACTTTTTTCCAGGGAGGGG - Exonic
1091604671 12:1940041-1940063 AATAACTTCCTTCAAAGGATTGG + Intergenic
1091810251 12:3391027-3391049 ACTAACTGGGTTCTAAGGAGTGG + Intronic
1092799344 12:12148376-12148398 AGTAGCTTACTTCAAAAGAGAGG - Intronic
1093522050 12:20062564-20062586 AGTGACTTGCTTCTAAGGGATGG + Intergenic
1094733981 12:33211431-33211453 AGTAACTGGCCTCAAAGAAGTGG + Intergenic
1095727957 12:45473172-45473194 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1096046643 12:48568328-48568350 GGAAAATTGCTACCAAGGAGCGG + Intronic
1097163205 12:57065337-57065359 AGTGCCTAGCTTCAAAGGAGGGG - Intronic
1099587038 12:84532245-84532267 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1100012384 12:89969194-89969216 AATAAAATGCTTCCAAGGCGTGG + Intergenic
1101502520 12:105317281-105317303 AGTAACTTGCTTGTAAGTGGTGG + Intronic
1104635106 12:130433592-130433614 AGGAACTGGCTTCCAATGAATGG - Intronic
1107972403 13:45655929-45655951 AGAAAATTGATACCAAGGAGTGG - Intergenic
1108035252 13:46284572-46284594 AGTAGCTTGCTTGCCAGGCGTGG + Intergenic
1109503701 13:63271051-63271073 AGGAAATTGGTACCAAGGAGCGG - Intergenic
1109853835 13:68102994-68103016 AGTAAATTGCTACCAAGTAGTGG - Intergenic
1111479831 13:88810281-88810303 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1112067781 13:95813101-95813123 AGAAAATTGGTACCAAGGAGTGG + Intronic
1113647642 13:112010586-112010608 AGCTACTTGCAGCCAAGGAGAGG + Intergenic
1113713004 13:112482942-112482964 AGTGCCTAGCTTCAAAGGAGGGG - Intergenic
1115038118 14:28885739-28885761 AGTGACTTGCTTCCAACAAAAGG + Intergenic
1117967944 14:61224798-61224820 AGAAACTTGCTTCCAAAGAGTGG - Intronic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1119706799 14:76788155-76788177 AGAAAATTGCTTCTTAGGAGTGG + Exonic
1119768772 14:77207174-77207196 AGAAACTTCCTGGCAAGGAGAGG + Intronic
1121541553 14:94731072-94731094 AGTGGCTTGCTTCCAAGTAGTGG + Intergenic
1126950955 15:53880666-53880688 AGCAACTTGCTTTTAAAGAGAGG - Intergenic
1127768465 15:62210746-62210768 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1129870709 15:78938952-78938974 AGTAAATTCCTTCCAAATAGTGG - Intronic
1133717751 16:8465763-8465785 AGTGACTTTCTTCCAGGGAAGGG - Intergenic
1134463683 16:14452683-14452705 AGTCTTTTGCTTCCTAGGAGAGG + Intronic
1135513493 16:23109587-23109609 AGTGACTTACTTCCAAAGACAGG + Intronic
1139213046 16:65099799-65099821 AATGACTTGCCTCCAAGCAGGGG + Intronic
1140793810 16:78416563-78416585 AGGAACTTGCTACCAAAGACAGG - Intronic
1141411125 16:83833839-83833861 AGTGACTTCCTTCCAAAGAGGGG + Intergenic
1145295902 17:21592689-21592711 TGTCACTGGCTTCCCAGGAGGGG - Intergenic
1145367883 17:22279373-22279395 TGTCACTGGCTTCCCAGGAGGGG + Intergenic
1149635315 17:58162811-58162833 AGTAGCTTGCTTCCAAGAGTGGG - Intergenic
1149677142 17:58476062-58476084 TGCAACTTGCTCCCAAGGACTGG + Intronic
1153578910 18:6551269-6551291 AGAAAATTGGTACCAAGGAGTGG - Intronic
1155257312 18:24009990-24010012 ACTAACTTGCCTCTAAGGAAGGG - Intronic
1155466270 18:26139088-26139110 AGTGACTTGCTTTTAAGGAATGG + Intronic
1156057575 18:33026819-33026841 AGTAACATCCTTCTAAGGTGAGG + Intronic
1156322213 18:36037554-36037576 AGTAAATTGGTACCAAGTAGTGG + Intronic
1159695508 18:71552298-71552320 AGGAAATTGGTACCAAGGAGTGG + Intergenic
1160285823 18:77542237-77542259 AGTAATTTGTTACCATGGAGTGG + Intergenic
1160442527 18:78903272-78903294 GGGCACTTGCTTCCAGGGAGTGG + Intergenic
1163551550 19:17968479-17968501 AGTAACTTGCTCCCTGGCAGGGG + Intronic
1164640907 19:29824976-29824998 TGTAACTTCCTTCCTAGGACTGG + Intergenic
1164851311 19:31486554-31486576 AGAAAATTGTTACCAAGGAGTGG - Intergenic
1167254147 19:48417264-48417286 AGCCACTTGCTTCCACAGAGTGG - Intronic
925287385 2:2724660-2724682 TGGAACCTGCTTCCAAGGTGGGG - Intergenic
927326377 2:21810369-21810391 ATAAACATTCTTCCAAGGAGAGG + Intergenic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
931789664 2:65653435-65653457 AGAAAGTTGTTTCCAAGGTGGGG - Intergenic
931801036 2:65757794-65757816 AGAAAATTGGTACCAAGGAGTGG - Intergenic
932734663 2:74246286-74246308 AGTAACTTGCTACCAACCAAGGG + Intronic
935330063 2:101970505-101970527 AGCAAATTGGTACCAAGGAGTGG - Intergenic
938250803 2:129814108-129814130 AGAAAATTGGTACCAAGGAGAGG + Intergenic
940481126 2:154232672-154232694 AGTAACTTGCTTCTATGTAGTGG - Intronic
942191585 2:173475903-173475925 AGCAACTTGCTTCTAACGAATGG + Intergenic
942774294 2:179562604-179562626 TGCAACTTGATTCCAGGGAGAGG + Intronic
943271434 2:185810619-185810641 AGAAAATTGGTACCAAGGAGTGG + Intronic
1168746404 20:246271-246293 AGGGATTTGCTTCAAAGGAGGGG + Intergenic
1172077895 20:32313603-32313625 GGTAACTTTGTTCCAGGGAGGGG + Intronic
1172254707 20:33507340-33507362 AGTAACATCCTACCAAGGATGGG + Intronic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1172956882 20:38766739-38766761 AGTAAAATGCCTGCAAGGAGGGG - Intronic
1176702935 21:10079956-10079978 AGAAACTTACATCCTAGGAGAGG + Intergenic
1177114995 21:17074416-17074438 AGCAACTTGCTTCTAATGAATGG - Intergenic
1181317052 22:21977777-21977799 ATTAAGTTCATTCCAAGGAGTGG - Intronic
1182518764 22:30873450-30873472 AGTCCCTGGCTTCCCAGGAGGGG - Intronic
950215993 3:11159865-11159887 AGGAACTTGCTACCAATCAGAGG + Intronic
951047570 3:18057614-18057636 AGTAAATTTCATCCAAGTAGAGG - Intronic
951251529 3:20399698-20399720 AGTAATTTGCTTTCCAGGAGTGG + Intergenic
952042714 3:29279826-29279848 AGCAACTGGCTTCCACCGAGGGG - Intergenic
954432714 3:50479770-50479792 AGGCACTTGATTCCAAGCAGAGG - Intronic
955193727 3:56785636-56785658 ATTATCTTGCTTCCCAGAAGAGG + Intronic
955301363 3:57783051-57783073 AGAAAATTGCTACCAAGAAGTGG + Intronic
957765852 3:84622658-84622680 AGTAAATTGGTTCCAAGTAGTGG - Intergenic
958058411 3:88444959-88444981 AGTAACTTTCTTCCAGGAAATGG - Intergenic
958528286 3:95291082-95291104 AGTAAATTGGTACCAAGTAGTGG + Intergenic
958824160 3:99009644-99009666 AGAAAATTGGTACCAAGGAGTGG - Intergenic
959765951 3:110028373-110028395 TGTAACTTGCTCCCAAACAGTGG + Intergenic
960724844 3:120659710-120659732 AGAAAATTGGTACCAAGGAGTGG - Intronic
962005430 3:131344541-131344563 AGAAAATTGATACCAAGGAGAGG - Intronic
963127726 3:141830744-141830766 TGCACCTTGCTTCCAGGGAGCGG + Intergenic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
965985108 3:174743136-174743158 AGGATTTTGCTTCCAAGAAGTGG + Intronic
967215681 3:187208129-187208151 AGAAAATTGCTACCAAGGAGTGG - Intergenic
967260387 3:187635827-187635849 AGAAAATTGATACCAAGGAGTGG - Intergenic
967397785 3:189025684-189025706 AGTAACTTGCTGACACTGAGAGG + Intronic
967592816 3:191298646-191298668 AGAAAATTGGTACCAAGGAGTGG + Intronic
967602533 3:191406461-191406483 AGAAAATTGGTACCAAGGAGTGG - Intergenic
967682408 3:192379730-192379752 AGTATATTGCTTCCAAAGTGTGG - Intronic
969913065 4:10462546-10462568 AGTAGCTTACTTCCAAGTAGGGG - Intergenic
969971911 4:11056471-11056493 GGTAACTTGCTTCCATGCAGAGG + Intergenic
970117823 4:12718987-12719009 AGTATCTTGCTTCCCAGCAGAGG + Intergenic
971054146 4:22893899-22893921 AGTAACTTGCTTCTAAAAAATGG - Intergenic
972367682 4:38391726-38391748 AGAAAATTGGTACCAAGGAGTGG + Intergenic
972897897 4:43645526-43645548 AGAAAATTGGTACCAAGGAGTGG - Intergenic
975095917 4:70456193-70456215 AGAAAATTGATACCAAGGAGCGG - Intronic
975467601 4:74726369-74726391 AGTAACTTTCTTCCAAAAATAGG + Intergenic
975521838 4:75310068-75310090 AGAAAATTGGTACCAAGGAGTGG + Intergenic
978109422 4:104944839-104944861 AGTATCATGTTTCCAAGAAGGGG + Intergenic
979027492 4:115596145-115596167 AGAAAATTGGTACCAAGGAGTGG + Intergenic
980375127 4:131936330-131936352 AGAAACTTACATCCTAGGAGAGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
983587929 4:169375759-169375781 AATAACCTGCTTCCTTGGAGAGG + Intergenic
984815712 4:183834131-183834153 TGTTACTTGCTTCCCAGGAGAGG + Intergenic
984859448 4:184224063-184224085 ATTAACTTGCACCAAAGGAGAGG - Intergenic
986409173 5:7459501-7459523 AGTAATTCGCCTCCAAGCAGTGG + Intronic
987178816 5:15345084-15345106 AGTAAGTTGCTCTCAAGGTGAGG + Intergenic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988671437 5:33385999-33386021 AGAAAATTGGTACCAAGGAGTGG - Intergenic
988936649 5:36090116-36090138 AGTAACTTCCTGCCATGGAAAGG + Intergenic
992136246 5:73749057-73749079 AGTGCCTTGGTCCCAAGGAGAGG - Intronic
994592782 5:101792717-101792739 AGTACATTGGTACCAAGGAGTGG - Intergenic
994996562 5:107071355-107071377 AGTAACTTTCTTCTGAGCAGTGG + Intergenic
996674375 5:126157397-126157419 AGAAAATTGGTACCAAGGAGTGG + Intergenic
997032653 5:130149206-130149228 AGAAAATTGGTACCAAGGAGTGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998108714 5:139484950-139484972 AGTAAGCTGCTTCAAAGAAGGGG + Intergenic
1000021969 5:157326008-157326030 AGTAAGTTGCTTCTAAGCGGTGG + Intronic
1002003073 5:176209299-176209321 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1002223387 5:177701649-177701671 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1003972710 6:11314379-11314401 AATAACTTCCTTCCAAAGAAAGG + Intronic
1004644075 6:17542634-17542656 ACTGACTTGCTTCCAAGAAGTGG + Intronic
1004986345 6:21087293-21087315 TGTAACTGCCTTCTAAGGAGCGG + Intronic
1005127914 6:22470191-22470213 TGTAACATGCTTCTAAGCAGTGG - Intergenic
1008117060 6:47563555-47563577 TGTAATTTTCTTACAAGGAGGGG + Intronic
1008292054 6:49727947-49727969 AGTGACTCACTTCCAAAGAGTGG - Exonic
1008708229 6:54190127-54190149 AGTAACTTACATCCAAGTAGAGG + Intronic
1010348372 6:74840408-74840430 AGAAAATTGTTACCAAGGAGTGG + Intergenic
1010542820 6:77113037-77113059 TGTAACTTGCTTCCAACCAGTGG - Intergenic
1012386343 6:98687722-98687744 AGCAACTTGCTTTCTAGCAGAGG + Intergenic
1012597448 6:101056339-101056361 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1012677796 6:102138716-102138738 AGAAAATTGATACCAAGGAGTGG - Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1016765927 6:147794030-147794052 AAAAACTTGCCTCCAAGGTGAGG + Intergenic
1018420116 6:163633854-163633876 AGTAACTGGCTTCTAATGAATGG - Intergenic
1018660307 6:166079707-166079729 AGTGAATTGCTTCAATGGAGAGG + Intergenic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1020384154 7:7579541-7579563 AGTAACTTGCTATAAAGCAGAGG + Intronic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1027844614 7:83356807-83356829 AGTAACTAGCTTTCTATGAGTGG + Intergenic
1028215133 7:88122358-88122380 TGTAACTTGCTTCCAACCAATGG - Intronic
1030490003 7:110220512-110220534 AGTAGCTTTCTTCTAAGGTGTGG - Intergenic
1033784724 7:144717026-144717048 AGAAAATTGGTACCAAGGAGTGG + Intronic
1034408095 7:150919495-150919517 AGGGACTTGCTTCCAAAGAACGG - Intergenic
1035864836 8:3070824-3070846 AGAAAATTGGTACCAAGGAGTGG - Intronic
1036822860 8:11954012-11954034 AGGAAGTTGCTCCCAGGGAGTGG + Intergenic
1037313752 8:17581878-17581900 AGAAAATTGGTACCAAGGAGTGG + Intronic
1037732687 8:21541516-21541538 AGAAAATTGCTGCCAAGGAGTGG - Intergenic
1038711725 8:29953176-29953198 AGATACATGATTCCAAGGAGAGG + Intergenic
1041619232 8:59946205-59946227 AGTCATTTGCTTGCAAAGAGAGG + Intergenic
1042660109 8:71144989-71145011 TGTACCTTTCTTCCAAGGGGTGG - Intergenic
1042796595 8:72670227-72670249 AGCAAGTTGCTTCTAATGAGTGG + Intronic
1043030827 8:75131355-75131377 AGTTAGTTGCTTCCAAGATGGGG - Intergenic
1043198996 8:77339476-77339498 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1045076379 8:98573739-98573761 AGTAAATTGGTACCAAGTAGTGG - Intronic
1046692108 8:117297284-117297306 AGTAACTTTCTTGTAAAGAGTGG - Intergenic
1051194495 9:14548042-14548064 AGAAAATTGGTGCCAAGGAGTGG - Intergenic
1051463425 9:17349951-17349973 ACTATCTAGCTTCCAAAGAGTGG - Intronic
1052193307 9:25682940-25682962 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1053640197 9:40066992-40067014 AGAAACTTACATCCTAGGAGAGG + Intergenic
1053765937 9:41398485-41398507 AGAAACTTACATCCTAGGAGAGG - Intergenic
1054320894 9:63662996-63663018 AGAAACTTACATCCTAGGAGAGG + Intergenic
1054544550 9:66309642-66309664 AGAAACTTACATCCTAGGAGAGG - Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1055800838 9:80033779-80033801 AGAAAATTGGTTCCAAGAAGTGG - Intergenic
1057642132 9:96834758-96834780 AGAAAATTGGTACCAAGGAGTGG + Intronic
1059373514 9:113863050-113863072 CGTAACTTGCTTCTAATCAGTGG - Intergenic
1061508216 9:131044554-131044576 AGTGACTTGCTTCTAATGACTGG + Intronic
1202787961 9_KI270719v1_random:50065-50087 AGAAACTTACATCCTAGGAGAGG + Intergenic
1185639044 X:1576334-1576356 ATCAAGATGCTTCCAAGGAGTGG - Intergenic
1187843058 X:23508775-23508797 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1189354921 X:40303376-40303398 AGTAAATTGCTTCCTGGGATGGG + Intergenic
1189506892 X:41620514-41620536 AGTATTGTGCTTGCAAGGAGGGG - Intronic
1189545821 X:42041880-42041902 AGTAACTGAATTCCAAGGACAGG + Intergenic
1193388079 X:80894354-80894376 AGTAAATTGGTACCAAGTAGTGG + Intergenic
1194417954 X:93636820-93636842 AGAAAGTTGGTACCAAGGAGAGG + Intergenic
1194462966 X:94195963-94195985 AGTAAGTTGGTACCAAGAAGTGG + Intergenic
1195649869 X:107273223-107273245 AGAAAGCTGCTTCCAAGAAGGGG + Intergenic
1197339934 X:125255173-125255195 TGTAACTTACTCCTAAGGAGTGG - Intergenic
1197460686 X:126736911-126736933 GGAAAATTGGTTCCAAGGAGCGG - Intergenic
1198243611 X:134808025-134808047 ACTAAGTTTCTTCAAAGGAGTGG - Intronic
1198503241 X:137274734-137274756 ACTAATTTGCTTCCATGGAGAGG - Intergenic
1199836293 X:151595220-151595242 AGTAACTAGATTCCCAGAAGAGG - Intronic