ID: 1014937553

View in Genome Browser
Species Human (GRCh38)
Location 6:127401624-127401646
Sequence AACTGAACCTAGGCCTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014937551_1014937553 -8 Left 1014937551 6:127401609-127401631 CCAATGGTGAACTTCAACTGAAC No data
Right 1014937553 6:127401624-127401646 AACTGAACCTAGGCCTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014937553 Original CRISPR AACTGAACCTAGGCCTATGC AGG Intergenic
No off target data available for this crispr