ID: 1014940179

View in Genome Browser
Species Human (GRCh38)
Location 6:127429046-127429068
Sequence GAGTCCTAGAAAATAAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014940176_1014940179 -3 Left 1014940176 6:127429026-127429048 CCAACTTCACCTCTCAACTAGAG No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940170_1014940179 20 Left 1014940170 6:127429003-127429025 CCTCACCAGACCCAGAAGCCCAG 0: 17
1: 279
2: 1263
3: 991
4: 943
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940174_1014940179 2 Left 1014940174 6:127429021-127429043 CCCAGCCAACTTCACCTCTCAAC No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940175_1014940179 1 Left 1014940175 6:127429022-127429044 CCAGCCAACTTCACCTCTCAACT No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940173_1014940179 9 Left 1014940173 6:127429014-127429036 CCAGAAGCCCAGCCAACTTCACC No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940171_1014940179 15 Left 1014940171 6:127429008-127429030 CCAGACCCAGAAGCCCAGCCAAC No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940169_1014940179 26 Left 1014940169 6:127428997-127429019 CCAAGTCCTCACCAGACCCAGAA No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data
1014940172_1014940179 10 Left 1014940172 6:127429013-127429035 CCCAGAAGCCCAGCCAACTTCAC No data
Right 1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014940179 Original CRISPR GAGTCCTAGAAAATAAGCCT GGG Intergenic
No off target data available for this crispr