ID: 1014940453

View in Genome Browser
Species Human (GRCh38)
Location 6:127432236-127432258
Sequence GCTTGCCCAAATCAACTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014940453_1014940455 6 Left 1014940453 6:127432236-127432258 CCAAACAGTTGATTTGGGCAAGC No data
Right 1014940455 6:127432265-127432287 AGGAAGAACAGTGTGTGCTGAGG No data
1014940453_1014940456 16 Left 1014940453 6:127432236-127432258 CCAAACAGTTGATTTGGGCAAGC No data
Right 1014940456 6:127432275-127432297 GTGTGTGCTGAGGTTGCTCATGG No data
1014940453_1014940457 22 Left 1014940453 6:127432236-127432258 CCAAACAGTTGATTTGGGCAAGC No data
Right 1014940457 6:127432281-127432303 GCTGAGGTTGCTCATGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014940453 Original CRISPR GCTTGCCCAAATCAACTGTT TGG (reversed) Intergenic
No off target data available for this crispr