ID: 1014940734

View in Genome Browser
Species Human (GRCh38)
Location 6:127435745-127435767
Sequence TTGTATGTGCATACCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 15, 3: 14, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014940734 Original CRISPR TTGTATGTGCATACCCTTGA TGG (reversed) Intergenic
900940350 1:5794673-5794695 GTGTGTGTGCATGCCCTTGCAGG - Intergenic
903275219 1:22217312-22217334 TAGTAACTACATACCCTTGAGGG - Intergenic
903873494 1:26455062-26455084 TCGTATATGCATACCCTTGATGG + Intronic
907708728 1:56856457-56856479 TGGTATTTCCATTCCCTTGATGG + Intronic
909572308 1:77129217-77129239 TTGTATATGCATACCCTTGATGG - Intronic
910016186 1:82527326-82527348 ATGTATGTGCATGGTCTTGAAGG + Intergenic
910395105 1:86785016-86785038 TCGTATATGCATACCCTTGATGG - Intergenic
911554525 1:99327368-99327390 ATGTGTGTGCATAACCTTTAAGG + Intergenic
911873012 1:103123125-103123147 TCTTTTGTGCATATCCTTGAGGG - Intergenic
912348893 1:108992385-108992407 TCGTATATGCATACCCTTGATGG - Intronic
914411722 1:147435588-147435610 TTGTATTTGCATATGCATGAAGG + Intergenic
914907908 1:151761823-151761845 TTGTACGTAAATATCCTTGAAGG + Intronic
919026815 1:192182415-192182437 TTCTACGTGCATATCCCTGATGG + Intronic
919956784 1:202425323-202425345 TTTTAGGTGCATTCCCTTAATGG + Intronic
920330275 1:205202294-205202316 TCGTATATGCATACCCTTGATGG - Intronic
921412421 1:214850020-214850042 TTGGATGTGGATACCTTTGGAGG - Intergenic
923527146 1:234781288-234781310 TTGTATGTGAACCACCTTGAGGG + Intergenic
924845116 1:247759872-247759894 ATGTATTTGCATGCCTTTGAGGG + Intergenic
1064350214 10:14569229-14569251 TTATATCTGCAAACCCATGAGGG - Intronic
1065809567 10:29428755-29428777 TTGTATGTTCATGACATTGAGGG - Intergenic
1066043732 10:31578769-31578791 ATGTATGTGCACCCCCTGGAAGG + Intergenic
1068378222 10:56212789-56212811 TAGTAGGTGCTTAGCCTTGAGGG - Intergenic
1068906606 10:62332895-62332917 GTGTATGTTCATATGCTTGATGG + Intergenic
1069125102 10:64620800-64620822 TTGAATATGCGTACTCTTGATGG + Intergenic
1070063208 10:73006470-73006492 TTGTATATACATACCCTTGATGG + Intergenic
1072215521 10:93284434-93284456 TCGTATATGCATACCCTTGATGG + Intergenic
1075011293 10:118872478-118872500 TCATATATGTATACCCTTGATGG + Intergenic
1078254555 11:9646892-9646914 TTGTAGGTTAATACCCATGATGG + Intergenic
1079962832 11:26945130-26945152 TTTAATGTGGATACCCTTGTTGG + Intergenic
1085157314 11:74307726-74307748 TTTTATGTGCAGATTCTTGAAGG - Intronic
1086062879 11:82718389-82718411 TTGTATGTGCAACCACTAGATGG + Intergenic
1086254453 11:84858215-84858237 TTTTATTTGCATATCCTTAAGGG + Intronic
1088694141 11:112352075-112352097 GTGTCTGTTCATATCCTTGATGG + Intergenic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1091701577 12:2666852-2666874 TAGTATGTTCATTCCCTTAAAGG - Intronic
1092858824 12:12701000-12701022 TTGGATGTATATGCCCTTGAGGG + Intergenic
1093184815 12:16007682-16007704 TTCTATGTGCCTGCCCTTCATGG - Intronic
1093777875 12:23098540-23098562 TTGAATGTGCATATTCCTGATGG + Intergenic
1095268810 12:40192369-40192391 GTGTATGTGTATACATTTGAGGG - Intergenic
1097583918 12:61492516-61492538 TAGGATGTGCACACCTTTGAGGG - Intergenic
1097603797 12:61728007-61728029 ATGTATTTGCATACTTTTGAGGG + Intronic
1099302475 12:80915043-80915065 TTGTCTGTTTATTCCCTTGATGG - Intronic
1101767872 12:107719700-107719722 TCATATATGCATACCCTTGATGG - Intergenic
1102120923 12:110440457-110440479 TTGTATGTGTTTTCCCTTTATGG - Intronic
1106418706 13:29567893-29567915 TGGAACGTGCATGCCCTTGAGGG + Intronic
1108982372 13:56533235-56533257 TTGTCTATGCATTCCTTTGAAGG - Intergenic
1112859191 13:103809083-103809105 TTGTATGTTCATAACCTTTCGGG - Intergenic
1117872190 14:60212790-60212812 TTGTATATGCATACCCCTGATGG + Intergenic
1118139917 14:63069604-63069626 ATGTATTTGCATAGCTTTGAGGG + Intronic
1119605406 14:76011889-76011911 CGGTATGTGCATACGCTTCAGGG - Intronic
1119978080 14:79048023-79048045 TTGTTTATCCATACTCTTGATGG - Intronic
1120148272 14:81003520-81003542 TCATATATGCACACCCTTGATGG + Intronic
1120400467 14:84024298-84024320 TTGAATGTGCATACCATTTCTGG - Intergenic
1122396935 14:101440494-101440516 TTGTATGTGGAACCCCTTGAAGG - Intergenic
1126244799 15:46491931-46491953 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1127223589 15:56906718-56906740 TTTTACTTGCATATCCTTGATGG + Intronic
1127883701 15:63180159-63180181 TTGTATTCTCATAACCTTGATGG + Intergenic
1128115952 15:65105637-65105659 TCATATATGCATACCCTTGATGG - Intronic
1128892219 15:71341587-71341609 TCGTATATGCATACCCTTGATGG + Intronic
1131975396 15:97940967-97940989 TTGAATGTGCAAAGCCTTGAAGG - Intergenic
1132926316 16:2431064-2431086 TTCTATATACACACCCTTGAAGG - Intronic
1133538321 16:6723515-6723537 TTGTATGTGCATAACATTTCTGG + Intronic
1134676520 16:16094466-16094488 TTGTACGTGCATACCTTTGATGG + Intronic
1135648942 16:24188554-24188576 TTATATGTCCATTCCCTTAAAGG + Intronic
1137223720 16:46481910-46481932 TGCTATGTGTACACCCTTGAGGG - Intergenic
1140650891 16:77087078-77087100 TTGTTTGGTCTTACCCTTGATGG - Intergenic
1145029983 17:19497093-19497115 TCGTATATGCACACTCTTGATGG - Intronic
1146785767 17:35719989-35720011 TTGGATATGCATACCTTTGATGG - Intronic
1150741769 17:67784854-67784876 TTGTATATGCATACGCTTGATGG - Intergenic
1156326903 18:36082305-36082327 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1157032994 18:43936290-43936312 TTGTCTGTGCAAAGCCATGAAGG + Intergenic
1157666372 18:49490883-49490905 TCGTATATGCATACCCTTGATGG + Exonic
1158942258 18:62415779-62415801 TTGTATATGCATAGCCTTGATGG - Intergenic
1162102272 19:8346618-8346640 TCATATATACATACCCTTGATGG - Intronic
1164551998 19:29219587-29219609 TTGTGTGTGCAGACCCTGCAGGG - Intergenic
1165177554 19:33941297-33941319 TTGTATTTGCATCCCCTGGGGGG - Intergenic
926473206 2:13287829-13287851 TGGTATGTGCATAAGTTTGAAGG - Intergenic
927024854 2:19056556-19056578 ATGTATGTGCATAGTTTTGAGGG + Intergenic
927126521 2:20016743-20016765 TTGAATGTGCATAGACTTGTAGG + Intergenic
928024693 2:27730036-27730058 GTATATTTGCATACACTTGAGGG + Intergenic
933409683 2:81909915-81909937 TTGTCTGTTCAAACCCCTGATGG + Intergenic
934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG + Intergenic
937014788 2:118595546-118595568 TTGCATGAGCATATCTTTGATGG - Intergenic
940048905 2:149439993-149440015 TTGTACATGCATACGCTTGATGG - Intronic
940683468 2:156816693-156816715 TTGTCTTTTCATTCCCTTGATGG - Intergenic
940740873 2:157506110-157506132 TTGAATGTGAATACTCTTAATGG - Intergenic
941066826 2:160913049-160913071 TTGTTTGTCTATACCCTTAATGG - Intergenic
944577407 2:201102834-201102856 TCGTGTATGCCTACCCTTGATGG + Intergenic
945470800 2:210225677-210225699 TAGTTTGAGCAAACCCTTGAAGG + Intergenic
947328543 2:229003989-229004011 TTATATATGCATACCCTTGGTGG - Intronic
948102990 2:235390222-235390244 TTCTTTCTGCATACCCTTCAGGG + Intergenic
1171958051 20:31474998-31475020 ATGTTAGTGCATCCCCTTGATGG + Intronic
1172092185 20:32441119-32441141 TTGTATGTGCATTCCATGGGGGG - Intergenic
1173036561 20:39417236-39417258 TTGGATGTGAACAGCCTTGAAGG + Intergenic
1176106057 20:63387979-63388001 TTGTATGTGCATACATGTGTGGG - Intergenic
1176949761 21:15031015-15031037 TTCTATGTGTATACTCTGGAAGG + Intronic
1182513381 22:30836417-30836439 TTGTATGTGCTTGCCATTAAGGG - Intronic
1182646914 22:31817442-31817464 TTATATATGCATACCCTTGATGG + Intronic
1182669060 22:31980668-31980690 TTGACTGTGCAAACCCATGAAGG + Intergenic
949637052 3:5994620-5994642 TTGGATGTTCATTCCCTTCAAGG - Intergenic
952699101 3:36306713-36306735 ATGTATGTGCATGCCAGTGAGGG + Intergenic
953467553 3:43136766-43136788 ATGTATGTTGATACGCTTGATGG + Intergenic
954076538 3:48186181-48186203 TGGTGTGTGCTTGCCCTTGAAGG - Intronic
956108219 3:65843994-65844016 TCATATCTGCATACCCTCGATGG - Intronic
957016099 3:75066774-75066796 ATGTATTTGCATACTTTTGAAGG + Intergenic
959655236 3:108796761-108796783 TTGTTAGTCCATATCCTTGAGGG - Intergenic
961853664 3:129847557-129847579 TTGTTTATCCATACACTTGATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965845371 3:172954697-172954719 CTGTATGTGCACAGCCTTGGAGG - Intronic
966980422 3:185128611-185128633 TTGTATCTGATTAACCTTGAAGG + Intronic
968329248 3:197850829-197850851 TCGTATATGCATACCCTTGGTGG + Intronic
969567392 4:7986652-7986674 TTCTTTGTGAATACCCCTGAAGG - Intronic
970557634 4:17250821-17250843 TTTTATGTGCATAGTCTTCATGG - Intergenic
973068923 4:45833273-45833295 TTGTATTTGCATGCTTTTGAAGG + Intergenic
974697153 4:65390605-65390627 TGGAATCTGCATACCCATGATGG - Intronic
975510011 4:75183748-75183770 ATGTATGTGCATGCTGTTGAGGG - Intergenic
975769469 4:77705786-77705808 TTCTTTGTGCATACTCTTCAGGG - Intergenic
978458683 4:108925561-108925583 TTGTATGTGTATGGCCTTGTAGG + Intronic
978571836 4:110146465-110146487 TTGTATATGCATACCTTTGATGG - Intronic
979774019 4:124564738-124564760 ATGTATGTACATACCCTTCATGG - Intergenic
984809314 4:183780513-183780535 TTGAATTTGCATTTCCTTGATGG + Intergenic
985215895 4:187653631-187653653 TTGTATTTGCATTTCCCTGATGG - Intergenic
987435520 5:17888423-17888445 ATGTGTGTGCAAACACTTGAAGG + Intergenic
989355211 5:40536639-40536661 ATGTATTTGCATAGTCTTGAGGG + Intergenic
991773689 5:70063176-70063198 TTGTAGGGGCATTCACTTGATGG + Intronic
991852983 5:70938600-70938622 TTGTAGGGGCATTCACTTGATGG + Intronic
994448339 5:99906755-99906777 TTTTATGTGAATCACCTTGATGG - Intergenic
998936924 5:147239123-147239145 CTGTTTCTGCATACCCTGGAGGG - Intronic
1005421624 6:25657075-25657097 TTGTGTGTGCTTACATTTGAGGG - Intronic
1005515095 6:26547078-26547100 TTGTATCTGCATATTCTTGTGGG + Intergenic
1010817355 6:80374444-80374466 TCATATATGCATACCCTTGATGG + Intergenic
1011894524 6:92208379-92208401 TTTTATGTAAATACCTTTGATGG + Intergenic
1012107701 6:95185607-95185629 TTGTATCTGCAAGCTCTTGATGG - Intergenic
1013727126 6:113112760-113112782 TTGTCTGTGCAGAGTCTTGAAGG + Intergenic
1014032626 6:116723326-116723348 GTGTGTGTGCATCCTCTTGAAGG + Intronic
1014940734 6:127435745-127435767 TTGTATGTGCATACCCTTGATGG - Intergenic
1016675653 6:146764460-146764482 TTGTATGTGCTTACAATTAAAGG + Intronic
1019433169 7:1008710-1008732 TTGTGTGTGCATCCCCAGGACGG - Intronic
1021197619 7:17690527-17690549 TTGTATGTGTATGTCCTTGTAGG + Intergenic
1022293123 7:29022705-29022727 TTGTATGCACACACCATTGAGGG + Intronic
1025800365 7:64781029-64781051 TTGTATTTCCATAGCCTTAAAGG + Intergenic
1027737038 7:81945596-81945618 TAGTATGTGGGTACCCGTGATGG - Intergenic
1030461843 7:109847992-109848014 TAGTATGTTTATGCCCTTGATGG - Intergenic
1030721807 7:112880821-112880843 TTGTATGTGTATATTATTGATGG + Intronic
1030757977 7:113313039-113313061 TTTTATGTGCCTTGCCTTGAAGG - Intergenic
1032766482 7:134998963-134998985 TTGAATGTGCATACACATGAAGG + Intronic
1037438100 8:18885967-18885989 TAGTATCTGAATAGCCTTGAAGG - Intronic
1038164541 8:25072621-25072643 TTGCATGTACAGACCCTTGTTGG + Intergenic
1038243837 8:25835267-25835289 TTGTAAGTGGATCCACTTGAAGG + Intergenic
1038677009 8:29632194-29632216 TCGTATATGCATACCCTTGATGG - Intergenic
1039000978 8:32979811-32979833 TTGTCTGTGGCTACCCATGAGGG + Intergenic
1039417081 8:37404643-37404665 TTGTATGTGCATACCTTACAGGG - Intergenic
1039785950 8:40834267-40834289 TTGCATGTGCCTGCCCTTGGAGG - Intronic
1042961674 8:74310048-74310070 TTGTCAGTGTGTACCCTTGATGG - Intronic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1056094843 9:83242483-83242505 TTGTGTGTTCTCACCCTTGAAGG + Intergenic
1059636502 9:116176462-116176484 TTGTTTTTTCATACCCTTTATGG + Intronic
1060207779 9:121692797-121692819 TTGATGGTGCATACCCTTGAGGG + Intronic
1185884094 X:3766686-3766708 TTGAATTTGCATATCTTTGATGG + Intergenic
1187014279 X:15310087-15310109 TTCTGTGTGAAAACCCTTGAAGG - Intronic
1191975323 X:66864765-66864787 CTGTCTGTGAAAACCCTTGAGGG + Intergenic
1194684977 X:96902075-96902097 ATGTATTTGCATAGCTTTGAGGG + Intronic
1196196748 X:112844691-112844713 TTTTATGTTTATATCCTTGAAGG - Intergenic
1198896684 X:141463373-141463395 TTGTAGGTGCATACACATTAAGG + Intergenic
1199688652 X:150289024-150289046 TTTTATTTGCATTTCCTTGATGG - Intergenic
1200781280 Y:7218250-7218272 TTGAATTTGCATATCTTTGATGG - Intergenic
1201673575 Y:16553476-16553498 TTATATATGCATACACTTGGTGG - Intergenic
1202577081 Y:26339214-26339236 TTTTAGGTGCATTCCCTTAATGG - Intergenic