ID: 1014942056

View in Genome Browser
Species Human (GRCh38)
Location 6:127453217-127453239
Sequence CAGGGTCAACGGACTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014942056 Original CRISPR CAGGGTCAACGGACTGAGGG AGG Intronic
902416792 1:16244444-16244466 CAGGCTTAACTGACAGAGGGAGG + Intergenic
902825409 1:18970129-18970151 CAGTGTCAAGTGACTGAAGGAGG + Intergenic
905896306 1:41547975-41547997 CAGGGTCAAAGGTCGGAGGCTGG - Intronic
912417202 1:109517588-109517610 CAGGGGCAAGGGGCTGGGGGAGG + Intergenic
913683464 1:121209023-121209045 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
914035305 1:143996647-143996669 CAGGGAAAAGGGGCTGAGGGAGG - Intergenic
914154148 1:145071323-145071345 CAGGGAAAAGGGGCTGAGGGAGG + Intronic
914826931 1:151143694-151143716 CAGGGTCATTTGGCTGAGGGAGG - Intronic
915322124 1:155061936-155061958 CCGGGTCAGCGGGCAGAGGGCGG - Exonic
919910268 1:202106770-202106792 CAGGGTCCTCAGGCTGAGGGCGG - Intergenic
920470772 1:206227532-206227554 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
924419236 1:243891921-243891943 CAGGCTAAATGGACTGAGAGTGG + Intergenic
1063486370 10:6424437-6424459 CATGGTCATCGGACTGCGGAAGG - Intergenic
1064967992 10:21034751-21034773 CAGGATCGATGCACTGAGGGAGG + Intronic
1069953988 10:72038610-72038632 CAGCGTCAACAGACTGGGGAAGG + Intergenic
1073260554 10:102186898-102186920 CAAGCCCAACTGACTGAGGGAGG + Intergenic
1073465542 10:103692845-103692867 CAGGGGCCATGGACTGAGGAGGG + Intronic
1077535275 11:3120992-3121014 CAAGGTCAAGGGCCTCAGGGAGG + Intronic
1077635909 11:3841116-3841138 CAGGGGCAGCGGACTGGGAGGGG - Intergenic
1078325208 11:10375100-10375122 CAGGGTCAAAGGTCAGAGAGAGG - Intronic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1079136285 11:17777490-17777512 AAGGGTCTCCGGGCTGAGGGAGG - Intronic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1080933420 11:36837418-36837440 CAGGGTCCAAGGCCTGTGGGAGG + Intergenic
1081738593 11:45422466-45422488 CAGGGCCAAAAGCCTGAGGGTGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG + Intergenic
1090948470 11:131451980-131452002 CAGGGTCATCGGAGAGCGGGAGG - Intronic
1090973907 11:131666171-131666193 CATGGTCAAGTGACTGAGTGAGG + Intronic
1091312152 11:134582189-134582211 CAGGGTCTAAGGATGGAGGGTGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1101254779 12:102966201-102966223 CAGGGTCAGCAGTCAGAGGGCGG + Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1111570435 13:90077698-90077720 GAGGGTCAGTGGACTGGGGGAGG - Intergenic
1113673812 13:112194807-112194829 CAGGGACAACGGGGTGAGCGCGG - Intergenic
1115859854 14:37672215-37672237 CTGGGTCAAGGGATGGAGGGAGG - Intronic
1116149196 14:41116763-41116785 CAGAGACAATGGACTGGGGGTGG + Intergenic
1119473116 14:74911460-74911482 CAGGGGCACCCGAATGAGGGTGG + Intronic
1122447528 14:101780900-101780922 CAGAGTCCAGGGACTGAGGCTGG + Intronic
1125297914 15:38222676-38222698 CAGGGTAAATGGTCTGAGAGTGG + Intergenic
1125395612 15:39244309-39244331 CAGGGCCATCTGACTGTGGGAGG + Intergenic
1125599492 15:40907485-40907507 CAGGGCCAAGGGGCTGAGTGGGG - Intergenic
1129341203 15:74888054-74888076 CAGGGTTAATGGATTAAGGGCGG - Intergenic
1129803674 15:78436941-78436963 CAGGGAAAATGGACAGAGGGAGG + Intergenic
1132354067 15:101158450-101158472 GAGGGTCAGAGGACTGAGTGAGG - Intergenic
1132411630 15:101582834-101582856 CAGGGTTTAAGGACTGAGTGTGG - Intergenic
1132587869 16:714157-714179 CTGGGTCAAGGGCCTGAGGAAGG - Intronic
1135401922 16:22172011-22172033 CAGGGGCAGCCGACTCAGGGAGG - Intronic
1137303152 16:47173232-47173254 CAGTGTTAACGTACTGTGGGTGG - Intronic
1138389072 16:56657452-56657474 CATGGCCAAAGGACTGAGGTGGG + Intronic
1139510974 16:67428438-67428460 CTGGGACAAAGGACTAAGGGAGG + Intergenic
1139595970 16:67958504-67958526 CAGGTTCAAGGGACTAAGGCTGG - Intronic
1140209701 16:72960391-72960413 CCGGGTCAACAGCCTGAGCGAGG + Intronic
1141553192 16:84819840-84819862 CAGGCTCAGCGGGCTGAAGGAGG - Intergenic
1142112926 16:88341721-88341743 CAGCGTCCACAGACTGGGGGTGG + Intergenic
1203142754 16_KI270728v1_random:1779245-1779267 CAGGGACAACGGACAGAAGTTGG + Intergenic
1142629563 17:1215916-1215938 CAGGGTAAATGGATTAAGGGCGG + Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1146545312 17:33733333-33733355 CAGGGAGAAAGGACTGATGGGGG - Intronic
1148437917 17:47696605-47696627 GAGGGTCAAAGGTCTGAGGCAGG + Intronic
1151018192 17:70581512-70581534 CAGGGGCAAGGGAGAGAGGGAGG - Intergenic
1151221369 17:72615433-72615455 CAGTGTAAGCGGACTGAGTGGGG + Intergenic
1151601560 17:75109377-75109399 AAGGGGCAAAGGACTGATGGGGG + Intergenic
1152420898 17:80192638-80192660 GAGGGTCAAGGCAGTGAGGGAGG - Intronic
1153253048 18:3141843-3141865 CAGGGACAATGGAGTGAGGGAGG - Intronic
1155810175 18:30222936-30222958 CAGGGGCTGCGTACTGAGGGAGG + Intergenic
1157723075 18:49940623-49940645 CAGAGTCGTCAGACTGAGGGGGG - Intronic
1159896562 18:74002169-74002191 CAGAGACAATGGACTCAGGGTGG - Intergenic
1160746986 19:716476-716498 CATGGTCAACAGACTGGTGGTGG + Intronic
1161594034 19:5142220-5142242 CAGGGTCTACGGCCCGTGGGGGG - Intronic
1162319004 19:9959913-9959935 CACGGTGAAAGGACTGAGGTCGG - Exonic
1165727503 19:38123518-38123540 CAGGGTTAATGGATTAAGGGCGG - Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166656237 19:44614065-44614087 CAGGGTCAAAGCTCTGAGTGGGG - Intronic
1167679692 19:50911559-50911581 CAGGGTCTAGGGACCCAGGGAGG + Intergenic
1168254437 19:55157954-55157976 CAGGGTCCTGGGACTGAGGGAGG - Intronic
927878357 2:26673812-26673834 CAGGGTCAAGGGACAGGGGGTGG + Intergenic
929384887 2:41394735-41394757 CAGGCTCAATGGAATGTGGGGGG + Intergenic
931849250 2:66236282-66236304 CAGGAGCAATGGACTGAGGGGGG + Intergenic
932478478 2:72024044-72024066 CAGGATCAAGGGACTGTGAGGGG + Intergenic
934197281 2:89849214-89849236 CATGGTCATCTGAATGAGGGAGG - Intergenic
935178992 2:100673799-100673821 CAGGGGCACAGGGCTGAGGGAGG + Intergenic
937293092 2:120793780-120793802 CAGGGTGAATGTAGTGAGGGAGG - Intronic
937891216 2:126940454-126940476 CAGGCTCAACTGGCAGAGGGAGG - Intergenic
938134881 2:128748707-128748729 CAAGGCCAATGGACTGAGGATGG - Intergenic
938589018 2:132719626-132719648 CAGGGTCTAGGGACAAAGGGAGG + Intronic
947927117 2:233931471-233931493 CAGGGTCAATGAACAGAGGAAGG + Intronic
948430044 2:237913046-237913068 CAGGGTCTACTGACAGTGGGCGG + Intergenic
949030928 2:241796919-241796941 CAGGGTGAGGGGACTGCGGGGGG + Intronic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1173401725 20:42731799-42731821 CATGTTGAAAGGACTGAGGGTGG - Intronic
1175971917 20:62690781-62690803 CATGGTAAACGGAATGAGGTTGG + Intergenic
1178881016 21:36450114-36450136 CAAGCTCAACTGCCTGAGGGTGG - Intergenic
1179786771 21:43734682-43734704 CTGGCTCAGGGGACTGAGGGTGG + Intronic
1180054158 21:45348655-45348677 CAGGCTCCAAGGGCTGAGGGCGG + Intergenic
1180588693 22:16917346-16917368 CATGGTCACCTGAATGAGGGAGG + Intergenic
1181030968 22:20148788-20148810 CAGGGTCAGCAGCCTGCGGGCGG + Exonic
1182087129 22:27568985-27569007 CAGGGTCACAGGCTTGAGGGTGG - Intergenic
1182354280 22:29715374-29715396 CAGAGGCAACAGACTGAGGCAGG + Intergenic
1182716884 22:32364092-32364114 CAGGGTGAAGGGAGTGGGGGAGG - Intronic
1183248359 22:36711029-36711051 CAGGATCCAGGGACAGAGGGAGG - Intergenic
1183848473 22:40562738-40562760 AAGGGGGAACGGACGGAGGGGGG + Intronic
1184236742 22:43187113-43187135 CAGGGCCGACGGACGGCGGGCGG - Exonic
1184243212 22:43222419-43222441 CAGGGTCAGGGGACCGTGGGAGG - Intronic
1184508644 22:44918979-44919001 CAGAGTCAAAGCACTGAGGGAGG - Intronic
1184707664 22:46225319-46225341 CAGAGTCAGGGGGCTGAGGGAGG + Intronic
1184794686 22:46725074-46725096 CAGGGACAATGGCCTGAAGGAGG - Intronic
1184818889 22:46893710-46893732 CAGGGCCAAAGGACTGAAGCTGG - Intronic
949499542 3:4666347-4666369 CAGTATCAACGCACTGAAGGTGG - Intronic
950533895 3:13568620-13568642 CAGGGCCAAGGGGCTGAGGCCGG - Intronic
950543903 3:13627732-13627754 CAGGGTCATGGGTCTGAGGGCGG + Intronic
951904224 3:27688312-27688334 CAGAGACAGCGGACTGCGGGTGG + Intergenic
952847379 3:37699804-37699826 CAGTGTCAACGCCCTGAGGCAGG - Intronic
953438217 3:42896658-42896680 CAGGATTAAGGGAATGAGGGGGG + Intronic
956216804 3:66857886-66857908 CAGGGGCACAGGCCTGAGGGTGG - Intergenic
956860903 3:73322685-73322707 CAGGGTCAAGGGCCGGAGGAGGG - Intergenic
963496127 3:146063862-146063884 CTGGGCCAAAGGACTGAGAGAGG - Intergenic
968628404 4:1638135-1638157 CAGGGTCACCTGCCTGAGGCCGG - Intronic
968912403 4:3482958-3482980 CGGGGTCAGGGGACTGAAGGGGG + Intronic
979413392 4:120406408-120406430 CAGAGACAGTGGACTGAGGGGGG + Intergenic
980048921 4:128019343-128019365 CATGGCCAATGGAGTGAGGGAGG - Intronic
987545372 5:19305655-19305677 CAGGGTCCACGGACTGTTGCGGG - Intergenic
990372717 5:55136885-55136907 CAGGGTCAAAAGACTTTGGGAGG + Intronic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
992106380 5:73451778-73451800 CAGGGGCAAAGGACAAAGGGCGG - Intergenic
994022574 5:95044642-95044664 CTGGGTTAAAGGACAGAGGGAGG - Intronic
996770470 5:127080349-127080371 CAGGGTCAATGGTGTGAGGGTGG + Intergenic
1000120881 5:158196875-158196897 CAGGAACAAGGGGCTGAGGGAGG - Intergenic
1001557099 5:172644005-172644027 CTGGGTCAAAGGAGTGAGTGGGG - Intronic
1002640974 5:180630476-180630498 CAGGGTCCACAGGCTGGGGGCGG + Intronic
1006670326 6:35726306-35726328 CAGTGCCCAGGGACTGAGGGTGG + Intronic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1007940642 6:45777896-45777918 CAAGGACAATGGATTGAGGGAGG - Intergenic
1008868796 6:56247516-56247538 CAGGGAGAACGGACTCCGGGCGG - Exonic
1012263040 6:97110621-97110643 CAGGGGAAATGTACTGAGGGAGG - Intronic
1012983442 6:105853358-105853380 CAGGGTAAATGGATTAAGGGCGG - Intergenic
1013342864 6:109232303-109232325 CAGAGACATGGGACTGAGGGAGG + Intergenic
1014897665 6:126922953-126922975 CAGGGTCAACTGACTGGAGGTGG - Intergenic
1014942056 6:127453217-127453239 CAGGGTCAACGGACTGAGGGAGG + Intronic
1016997384 6:149970064-149970086 AAGGCTCCAGGGACTGAGGGTGG - Exonic
1018059708 6:160080718-160080740 CAGGGGCAAGGCACTGAGTGTGG - Intronic
1018735935 6:166687238-166687260 CAGGGTCAACGAAGCGAGGCAGG - Intronic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1026937658 7:74267979-74268001 CAGGGTCAGCGGGCTGTGAGTGG + Intergenic
1030086936 7:105824034-105824056 CAGAGTGGATGGACTGAGGGTGG + Intronic
1031850716 7:126859119-126859141 CAGGGGCAGGGGACTGGGGGTGG - Intronic
1042750849 8:72156020-72156042 CAGGGGCAAGAGAGTGAGGGGGG + Intergenic
1044927523 8:97222226-97222248 CAGGGAGAGAGGACTGAGGGAGG - Intergenic
1047333531 8:123914735-123914757 CAGAGTCAAAGGACTGGGAGAGG + Intronic
1050160804 9:2717427-2717449 CAGGGTCAAGGGAGTGGGGGAGG + Intergenic
1050614531 9:7388241-7388263 CAGGATCAACTGGCAGAGGGTGG - Intergenic
1050642289 9:7680988-7681010 GGGGGTCAGCGCACTGAGGGAGG - Intergenic
1055915961 9:81400510-81400532 CAGTGTCAATTGACTGATGGTGG + Intergenic
1056109667 9:83382625-83382647 CAGGATCAAAGGACTGAGTCAGG - Intronic
1059413403 9:114148560-114148582 CATGGCCAACAGACTGAGGGTGG - Intergenic
1060211964 9:121716060-121716082 CAGGGTCACAGGTCTAAGGGGGG + Intronic
1061455588 9:130695199-130695221 CAGGGTCAATGGTATGTGGGGGG + Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1062267474 9:135693899-135693921 CAGGGCAGACGGACTGAGGTGGG - Intronic
1062688057 9:137826479-137826501 CAGCCTCAACGGACTGAGACAGG - Intronic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186169529 X:6862041-6862063 AACGGTCAAGGGAATGAGGGTGG + Intergenic
1190640772 X:52481606-52481628 CAGGGTCACTGGACTGGGGAGGG - Intergenic
1190646900 X:52531259-52531281 CAGGGTCACTGGACTGGGGAGGG + Intergenic
1192252311 X:69422722-69422744 CAGGGTAAATGGATTAAGGGCGG + Intergenic
1198464183 X:136889913-136889935 CAGCCTGAACGGACTGAGAGAGG + Intergenic
1199439728 X:147854611-147854633 CAGAGTCAGTGGACTGGGGGTGG - Intergenic