ID: 1014945129

View in Genome Browser
Species Human (GRCh38)
Location 6:127488211-127488233
Sequence CCACTTCCATAGTCTCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014945124_1014945129 11 Left 1014945124 6:127488177-127488199 CCTGCAACATTCTTCCATCATAT 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 160
1014945123_1014945129 17 Left 1014945123 6:127488171-127488193 CCTCTGCCTGCAACATTCTTCCA 0: 1
1: 1
2: 29
3: 185
4: 900
Right 1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 160
1014945125_1014945129 -3 Left 1014945125 6:127488191-127488213 CCATCATATACTCTCATGACCCA 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014945129 Original CRISPR CCACTTCCATAGTCTCTTCA GGG Intronic
905768159 1:40620383-40620405 CTACTTCCATAGACTCCACAAGG - Intergenic
908146494 1:61250476-61250498 CCACTTCCATATGATCTACATGG + Intronic
909301904 1:74023306-74023328 CCACCTCCACCATCTCTTCAAGG + Intergenic
909916325 1:81324116-81324138 CCACTACAATAGCCTCTTAAAGG - Intronic
913001779 1:114587776-114587798 CCACTTCCTGGATCTCTTCATGG - Exonic
916451788 1:164927945-164927967 CCTCTTCCCTTTTCTCTTCAAGG + Intergenic
916618269 1:166467768-166467790 TCACTTCCACAGTGTCTTGAGGG - Intergenic
916969794 1:170000332-170000354 CCACTTCTATTATCTTTTCATGG - Intronic
917671740 1:177280015-177280037 CAACTTCCATTCCCTCTTCAAGG - Intronic
917930186 1:179817513-179817535 CCACTTCTGTAGTCTCTGCTGGG - Intergenic
920615572 1:207489315-207489337 TCACTGCCATATACTCTTCAAGG + Exonic
920642542 1:207767174-207767196 CCAGTTCCAAAGTGTCTTAAAGG + Exonic
921261099 1:213385769-213385791 CCACTTCCTTAGACACTACAGGG + Intergenic
921946600 1:220890091-220890113 CCACTTCCAAGGTCTCTTTCTGG - Intergenic
922026442 1:221754164-221754186 ACACTTCCAAAGTCTATTCCAGG - Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064021504 10:11813046-11813068 TCACTTCCCAAGTCTCTACATGG - Intergenic
1064032185 10:11889877-11889899 CCACTCTCATAGCCTATTCAAGG - Intergenic
1064423552 10:15210647-15210669 CAACTTCCTTATTCTTTTCAGGG + Intergenic
1065451381 10:25862219-25862241 CTACTTCCGTAACCTCTTCAGGG - Intergenic
1065559865 10:26952054-26952076 CTACTTCCCTAATTTCTTCAGGG + Intergenic
1067321430 10:45224531-45224553 CCTCTTCCATATTCTTTTAAGGG - Intergenic
1068478337 10:57557184-57557206 CCACTTAAATAGTCACATCATGG - Intergenic
1073429163 10:103475135-103475157 CCAAAGCCATAGTCTCTTTAAGG + Intronic
1073733186 10:106315498-106315520 CCAATTGCATAGTTACTTCATGG + Intergenic
1074593266 10:114835408-114835430 CCAGTTGCATTGTCTTTTCAAGG + Intronic
1074716228 10:116221976-116221998 CCCCTTCCTTACTCTCTTCTTGG - Intronic
1076023706 10:127094795-127094817 CCAGTTCCACAGTATCTTAAGGG - Intronic
1076359484 10:129877050-129877072 CAACTGCCAGAGTCTCTTCCTGG - Intronic
1081355901 11:42113337-42113359 ACACCACCATACTCTCTTCATGG + Intergenic
1081556867 11:44172349-44172371 CCACTGCCACAGTTTCTACAAGG - Intronic
1081567672 11:44270015-44270037 CCACTTCCACAGTCCCACCATGG - Intronic
1083529273 11:63403930-63403952 TAACCTCCATAGTGTCTTCATGG - Intronic
1086909846 11:92459465-92459487 CCACTTCCATATTATTTTAACGG + Intronic
1088179314 11:107091547-107091569 ACACTTCCAAAGTCTTTTTAAGG + Intergenic
1088750968 11:112841848-112841870 CCACATCCTGAGTCCCTTCAGGG + Intergenic
1089332132 11:117696950-117696972 CCTCCTCCACAGACTCTTCAGGG + Intronic
1089960521 11:122613726-122613748 CCACTTGCTTAGTTTCTTGATGG + Intergenic
1090082935 11:123626505-123626527 CCACTTCTTTAAGCTCTTCAGGG + Intronic
1090288246 11:125518974-125518996 TCACTTCCATAATGTTTTCAAGG - Intergenic
1093876311 12:24353327-24353349 GCCCTTCCATAGTTTCTTTACGG - Intergenic
1097000602 12:55873285-55873307 ACAATCCAATAGTCTCTTCATGG + Intergenic
1100177052 12:92042793-92042815 TTAATTCCATTGTCTCTTCAAGG - Intronic
1100519710 12:95362096-95362118 CCACTTCAATAATCTCTTCATGG - Intergenic
1100849985 12:98699479-98699501 TCACTTCCATATCCTCTTGAGGG - Exonic
1103185793 12:118956089-118956111 CCCCTTCCCTTGTCTCTTCTTGG + Intergenic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1105663025 13:22520257-22520279 TGACTTCCATAGTTTCTTTAAGG - Intergenic
1107167220 13:37297232-37297254 CCACTACCACATTCTTTTCATGG + Intergenic
1108208696 13:48116961-48116983 CAACCTCCATAGACTCTTCAGGG - Intergenic
1110358966 13:74603527-74603549 CTGCTAACATAGTCTCTTCAAGG - Intergenic
1111689206 13:91540215-91540237 GCCCTTCCAGACTCTCTTCAGGG + Intronic
1116622861 14:47227855-47227877 TCACTTCCTCAGTCACTTCATGG + Intronic
1116747574 14:48841136-48841158 CGACTTACTCAGTCTCTTCAAGG + Intergenic
1117559912 14:56926741-56926763 TCACTTGCATAGTGTCATCAGGG + Intergenic
1118896704 14:69951257-69951279 CCACTCCCATAGTATTTTCTTGG + Intronic
1120515849 14:85469075-85469097 TCACTTCCTTAGTGTCTGCAGGG + Intergenic
1120711052 14:87793474-87793496 CCACTTCCAGGGTCTCTTGTTGG - Intergenic
1126757913 15:51942189-51942211 CCCCTGCCATTGCCTCTTCATGG - Intronic
1128090174 15:64913849-64913871 CCCTTTCCATAGTCACTGCAGGG - Intronic
1129850440 15:78790738-78790760 CCACTTGCAGAAGCTCTTCAGGG + Exonic
1130251827 15:82304784-82304806 CCACTTGCAGAAGCTCTTCAGGG - Intergenic
1133055958 16:3145608-3145630 TGGCTTCTATAGTCTCTTCAGGG - Intronic
1133452462 16:5915144-5915166 CCACTCCCTTTGTCTCTTCTAGG + Intergenic
1133581921 16:7152811-7152833 CACCTTCCATTGTCTCTTCTAGG - Intronic
1135863758 16:26081489-26081511 CCACTTGCATAAACTCCTCAGGG - Intronic
1140183554 16:72745729-72745751 CCACTTACATAATGTTTTCAAGG - Intergenic
1141352855 16:83314953-83314975 CCACCTCCCAAGTCTTTTCAAGG - Intronic
1142402857 16:89870039-89870061 CCACTTCCCAGGTCTCTGCAAGG + Exonic
1143615236 17:8045665-8045687 CCACTGCCACCCTCTCTTCAAGG + Exonic
1144103209 17:11962211-11962233 CTACATCCATGGCCTCTTCATGG + Exonic
1146595463 17:34164636-34164658 CCAGTTCCATTATCTCATCAGGG - Intronic
1147285556 17:39400896-39400918 CCACTTCCCTAGTTTCACCAAGG + Intronic
1147690272 17:42310543-42310565 CCACATCCATGGTCTCATCCAGG - Exonic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1153737843 18:8090953-8090975 CCTCTTCCCTAGTCTTTACAAGG + Intronic
1156243881 18:35279044-35279066 CTATTTCTACAGTCTCTTCAAGG + Intronic
1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG + Intronic
1160228959 18:77032141-77032163 CAAATTCCATGGTCTCTGCAGGG - Intronic
1161039648 19:2103434-2103456 CTTCTTCCACAGTCACTTCAGGG - Intronic
1164109337 19:22140320-22140342 TCACTTCCCTGGACTCTTCACGG + Intergenic
1164157402 19:22604945-22604967 CCACTTCCTAAGTCCCTTCCTGG - Intergenic
1165119055 19:33547347-33547369 CGACTTTCCTAGGCTCTTCATGG + Intergenic
928368718 2:30723296-30723318 CCACTTCCATGGTCACTCAAAGG - Intronic
931334896 2:61329652-61329674 CCACATCCAGAGATTCTTCATGG - Intronic
932487888 2:72095932-72095954 AGACTTCCTTAGCCTCTTCAGGG + Intergenic
934557851 2:95296886-95296908 CCACTTCCACAGTCCCTCCTGGG + Intergenic
937016200 2:118608310-118608332 CCACTTCCATTTCCACTTCAAGG - Intergenic
939543452 2:143521999-143522021 ACACTTCTGTAGTCTCTCCAAGG + Intronic
940479597 2:154211813-154211835 CCACTTTCATACTCACTTCTTGG - Intronic
940594676 2:155775196-155775218 TCAGTTCCTGAGTCTCTTCAGGG + Intergenic
941139667 2:161763703-161763725 CCTCTGGCATGGTCTCTTCATGG + Intronic
943101615 2:183493455-183493477 CCATTTCCAGAGTCTCTGAATGG + Intergenic
944404858 2:199372600-199372622 CCACTAACAGAGTGTCTTCATGG - Intronic
1171395543 20:24830541-24830563 TGACTTCCATAGGCTCTACATGG - Intergenic
1175110764 20:56646405-56646427 CCTTTTCCAGAGCCTCTTCAGGG + Intergenic
1175602926 20:60289583-60289605 CCACTTCTGTGGTCTTTTCATGG + Intergenic
1179571059 21:42279194-42279216 CCACTTCCACCGTCTCTCCTTGG - Intronic
949216853 3:1581205-1581227 TCATTTCCATAGACTATTCATGG - Intergenic
950798456 3:15530406-15530428 CCACCTCCATTGTCACTTCTTGG - Intergenic
952596935 3:35029136-35029158 CCATTTCCAAAGTCACTTCCAGG + Intergenic
953474442 3:43193905-43193927 GCCCTTCCTTTGTCTCTTCAGGG + Intergenic
954577276 3:51683561-51683583 CCACTTCCTAAGTCCCTTCCTGG - Intronic
956982657 3:74656827-74656849 CCACTTCTAAAGTCTATGCATGG - Intergenic
957243989 3:77695167-77695189 CCACTCACATTGTCTCTTGATGG - Intergenic
959820500 3:110729798-110729820 CCACTTCCCAACTCTCTTCCTGG + Intergenic
962987418 3:140548159-140548181 CCACTTCCATAATCGTTCCATGG + Intronic
965681739 3:171258768-171258790 CCACTTCCAGAGTTTCTTAGAGG - Intronic
966757072 3:183381281-183381303 CCTCTTCTATAGTTTCTTCGTGG - Intronic
967809546 3:193745373-193745395 CCTCTTCCATCGGCTCTTCCGGG - Intergenic
969095976 4:4733251-4733273 CCACTTTCAGAGCCTCTGCAGGG + Intergenic
970604611 4:17667488-17667510 CCACTTCCAGAGAATCATCATGG + Intronic
970681506 4:18513881-18513903 CCTCTTCCTAATTCTCTTCAGGG + Intergenic
971470192 4:27016823-27016845 CCACTTCACTAGTCACTTCCTGG - Intronic
972148964 4:36064953-36064975 CCACTTCTATTGTCTGTTCTTGG - Intronic
972733410 4:41817078-41817100 CCACACCTATACTCTCTTCAAGG - Intergenic
972946438 4:44262345-44262367 CCACTACCCTACTCTCTCCATGG + Intronic
978955230 4:114604045-114604067 CAACTTCCACTCTCTCTTCAAGG - Intronic
981137826 4:141232649-141232671 TCACTTCCTTAGTATCTTAAGGG - Intronic
983378676 4:166962696-166962718 CGACTTCCATAGACCCTACAAGG + Intronic
995028319 5:107449825-107449847 CCTCTTCCAAAGTCTTTTGAAGG + Intronic
995474449 5:112533791-112533813 CCACTTCCACACCATCTTCAAGG - Intergenic
996339342 5:122418914-122418936 CCTCTCCCACAGTCTCTGCAAGG - Intronic
997871613 5:137510783-137510805 CCACTTCCATCGTGTCCCCAGGG + Intronic
1001430720 5:171659840-171659862 CCAGTTCCAATGTCTCTTAAGGG - Intergenic
1003631227 6:7789657-7789679 CCAGTTCCAAAGTGTCTTGACGG + Intronic
1005455278 6:26014130-26014152 CCCCTTCCAAACTCTCTTGAAGG - Intergenic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1010602127 6:77842122-77842144 CCAAATTCATAGTCTTTTCAAGG + Intronic
1012087066 6:94841415-94841437 CCACTTCTACAGTATGTTCAAGG + Intergenic
1012374399 6:98543765-98543787 GCACTCACATAGTCTCTTAAGGG + Intergenic
1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG + Intronic
1016377671 6:143440203-143440225 AGTCTTCCAAAGTCTCTTCAGGG - Intronic
1017335549 6:153255021-153255043 CTAGTTGGATAGTCTCTTCATGG + Intergenic
1017821866 6:158054829-158054851 CCACCTCTGTGGTCTCTTCAGGG - Intronic
1018337616 6:162811108-162811130 CCACTTCCATCTACCCTTCAAGG - Intronic
1019041342 6:169108600-169108622 CCAGTTCCACAGTCACTTCCAGG - Intergenic
1019353629 7:567738-567760 TCACTTGCATAGTGTCCTCAAGG - Intronic
1019801534 7:3091632-3091654 CCATTTCCAGATTCCCTTCAGGG + Intergenic
1022434811 7:30372721-30372743 TCAATTCCATAGTTTCTTGATGG - Intronic
1022459583 7:30592987-30593009 ACACTTCAGTAGGCTCTTCATGG - Intergenic
1023520726 7:41047706-41047728 CCATTTCTATTGTCTCTTCTGGG + Intergenic
1023843320 7:44108416-44108438 CCACTGCCCCACTCTCTTCAGGG + Intronic
1023959148 7:44912328-44912350 CCAATTCCATAGTCTTCCCACGG + Intergenic
1027991088 7:85361451-85361473 CCAAGTCCAAAGTCTCATCAAGG - Intergenic
1028719541 7:94012881-94012903 CCACTTCTGTGGTATCTTCAGGG - Intergenic
1028977417 7:96929594-96929616 CTACTACCACAGCCTCTTCATGG + Intergenic
1029961549 7:104693267-104693289 CCAAGTCCATAGTCTCATCTGGG - Intronic
1037993826 8:23338981-23339003 CCTCTTCCATGTTCTCTTCCAGG + Intronic
1042215245 8:66424726-66424748 CTGCTTCCATACTCTTTTCAGGG - Intergenic
1044018002 8:87070156-87070178 CTTCTTCCATTGTCACTTCATGG + Intronic
1044578872 8:93802213-93802235 CCATCTCCACAGTCCCTTCATGG + Intronic
1048168850 8:132086132-132086154 CCACTTCCTTCTTTTCTTCATGG - Intronic
1049013260 8:139902249-139902271 CCACTTTCAAAGTCATTTCAAGG + Intronic
1055370207 9:75590398-75590420 CCACTTCCATTGGCTCTCCAGGG - Intergenic
1056267319 9:84911332-84911354 CCAATTCCACAGTCTCATCCAGG - Intronic
1188301553 X:28510531-28510553 CCATTTTCAAAGTCACTTCATGG + Intergenic
1188433475 X:30133756-30133778 CCACTTCGATAGCCTTTTGAAGG - Intergenic
1188481396 X:30640175-30640197 ACACTGCCATGGTCTCATCATGG + Intergenic
1193463608 X:81819004-81819026 TATCTTCCATAGTCTTTTCAGGG + Intergenic
1194878253 X:99217384-99217406 CCACTTCCTTCATGTCTTCATGG - Intergenic
1196420357 X:115514704-115514726 CCACTTCAATTGTCTCTACCTGG + Intergenic
1198083176 X:133258781-133258803 TCACTTACATAATGTCTTCAGGG - Intergenic
1198333102 X:135640423-135640445 CATCTTCCATCTTCTCTTCAGGG + Intergenic
1198366920 X:135950280-135950302 CCACTTCCATCTTCTCCTCATGG + Intergenic
1198530269 X:137545546-137545568 CCACCTCCACCGTCTCTTCGCGG - Intergenic
1198722719 X:139640658-139640680 CCAATTCCAGAGACCCTTCAAGG + Intronic