ID: 1014954829

View in Genome Browser
Species Human (GRCh38)
Location 6:127601910-127601932
Sequence GGTAAATGGGATTGCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014954829_1014954837 11 Left 1014954829 6:127601910-127601932 CCTTTTTGGCAATCCCATTTACC No data
Right 1014954837 6:127601944-127601966 CTCCCTTTTGGATACTCCAGGGG No data
1014954829_1014954834 9 Left 1014954829 6:127601910-127601932 CCTTTTTGGCAATCCCATTTACC No data
Right 1014954834 6:127601942-127601964 ACCTCCCTTTTGGATACTCCAGG No data
1014954829_1014954836 10 Left 1014954829 6:127601910-127601932 CCTTTTTGGCAATCCCATTTACC No data
Right 1014954836 6:127601943-127601965 CCTCCCTTTTGGATACTCCAGGG No data
1014954829_1014954833 -1 Left 1014954829 6:127601910-127601932 CCTTTTTGGCAATCCCATTTACC No data
Right 1014954833 6:127601932-127601954 CTAAATATGTACCTCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014954829 Original CRISPR GGTAAATGGGATTGCCAAAA AGG (reversed) Intergenic